Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CymR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector: O-acetyl-L-serine; CysK, cysteine synthetase
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 69 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 21 12
Staphylococcus capitis SK14 20 9
Staphylococcus epidermidis ATCC 12228 21 10
Staphylococcus carnosus subsp. carnosus TM300 16 9
Staphylococcus haemolyticus JCSC1435 17 8
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 23 10
Macrococcus caseolyticus JCSC5402 10 6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tcyP
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -54
score = 5.7921
sequence = TTATTCTTAGCATACTAGTCGGAATTA

Gene: SA0368: L-cystine uptake protein tcyP
*
Staphylococcus capitis SK14

Site:
position = -57
score = 5.09002
sequence = ATATCCTTATTATATATGTCGGAATAC

Gene: STACA0001_1450: L-cystine uptake protein tcyP
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -56
score = 5.29314
sequence = TTATTCTTATTACATATGTCGGAATAC

Gene: SE2354: L-cystine uptake protein tcyP
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -269
score = 5.03927
sequence = TAAATACGATATATTTACTAAGGATTT

Site:
position = -151
score = 4.29571
sequence = TTTTACCTACATAACTACTATTTAAAA

Gene: Sca_0042: L-cystine uptake protein tcyP
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -49
score = 5.41275
sequence = TTATCCTTATTAAGTATGTCGGAATTA

Gene: SH2589: L-cystine uptake protein tcyP
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -63
score = 4.61715
sequence = ATATCCTTAGTATACGTATCGGATTTC

Gene: SSP2329: L-cystine uptake protein tcyP
*
Macrococcus caseolyticus JCSC5402

Site:
position = 32
score = 5.53366
sequence = TAATTCTTAgTAtTcTtATAGGAtTac

Gene: MCCL_0267: L-cystine uptake protein tcyP
L-cystine uptake protein tcyP
 
CRON 2.
tcyA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -40
score = 6.18547
sequence = TTATTCCGATTAGAATAATAAGAATAA

Gene: SA2202: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
*
Staphylococcus capitis SK14

Site:
position = -40
score = 6.04113
sequence = TTATTCCGATTAGAATAATAAGATTAA

Gene: STACA0001_1063: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -40
score = 6.18547
sequence = TTATTCCGATTAGAATAATAAGAATAA

Gene: SE1993: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -40
score = 5.35489
sequence = TTATTCCGATGAGAATGATAAGGATAA

Gene: Sca_1910: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -41
score = 5.90865
sequence = TTATTCTGACTAATCTAATAGGAATAT

Gene: SH0639: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -37
score = 5.81712
sequence = TTATTCCGATAAGAATAATAAGAATAG

Gene: SSP0242: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
*
Macrococcus caseolyticus JCSC5402

Site:
position = -38
score = 5.25548
sequence = CTATTCCGAGTAAATTGATATGAATAG

Gene: MCCL_1425: L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
L-cystine uptake ABC transporter, L-cystine-binding protein TcyA
tcyB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2201: L-cystine uptake ABC transporter, permease protein TcyB
 
Staphylococcus capitis SK14

Gene: STACA0001_1064: L-cystine uptake ABC transporter, permease protein TcyB
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1992: L-cystine uptake ABC transporter, permease protein TcyB
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1909: L-cystine uptake ABC transporter, permease protein TcyB
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0640: L-cystine uptake ABC transporter, permease protein TcyB
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0243: L-cystine uptake ABC transporter, permease protein TcyB
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1424: L-cystine uptake ABC transporter, permease protein TcyB
L-cystine uptake ABC transporter, permease protein TcyB
tcyC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2200: L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
Staphylococcus capitis SK14

Gene: STACA0001_1065: L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1991: L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1908: L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0641: L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0244: L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1423: L-cystine uptake ABC transporter, ATP-binding protein TcyC
L-cystine uptake ABC transporter, ATP-binding protein TcyC
 
CRON 3.
ssuB
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -41
score = 6.02987
sequence = TAATTCCTATTAAAATAGTAGGGATTA

Gene: SA0166: sulfonate ABC transporter, ATPase component
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -41
score = 5.71783
sequence = CAATTCTTATTAAAACGATAAGAATAA

Gene: SSP0459: sulfonate ABC transporter, ATPase component
 
Macrococcus caseolyticus JCSC5402
sulfonate ABC transporter, ATPase component
ssuA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0167: sulfonate ABC transporter, substrate-binding component
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0458: sulfonate ABC transporter, substrate-binding component
 
Macrococcus caseolyticus JCSC5402
sulfonate ABC transporter, substrate-binding component
ssuC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0168: sulfonate ABC transporter, permease component
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0457: sulfonate ABC transporter, permease component
 
Macrococcus caseolyticus JCSC5402
sulfonate ABC transporter, permease component
SA0169
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0169: putative acyl-CoA dehydrogenase
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0456: putative acyl-CoA dehydrogenase
 
Macrococcus caseolyticus JCSC5402
putative acyl-CoA dehydrogenase
 
CRON 4.
SA2080
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -62
score = 4.58556
sequence = TAAAGTCGAGTGTTAAACTAGGAATAA

Gene: SA2080: putative acyl-CoA dehydrogenase
*
Staphylococcus capitis SK14

Site:
position = -57
score = 4.21229
sequence = AAAAGTCGAGTGTTAAACTAGGATTAA

Gene: STACA0001_1208: putative acyl-CoA dehydrogenase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -65
score = 4.41296
sequence = TAAAGTCGAGTGTTAAACTATGAATAA

Gene: SE1858: putative acyl-CoA dehydrogenase
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -56
score = 4.38511
sequence = TTAATCCGAGTGATACACTAAACTTAA

Gene: Sca_1777: putative acyl-CoA dehydrogenase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -266
score = 4.35193
sequence = TAATGTCGAGTGATAAACTAGGTTTAA

Gene: SH0767: putative acyl-CoA dehydrogenase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -110
score = 5.12883
sequence = TAAATCTTATCGGTAAAGTAAGGATTT

Gene: SSP0622: putative acyl-CoA dehydrogenase
*
Macrococcus caseolyticus JCSC5402

Site:
position = -256
score = 4.54588
sequence = TATTTCCTAGATAATAAATAATGTATT

Gene: MCCL_0131: putative acyl-CoA dehydrogenase
putative acyl-CoA dehydrogenase
 
CRON 5.
SA1850
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -40
score = 5.17471
sequence = TAATACATACTAAACTTATCGGAAATG

Gene: SA1850: putative transporter for thiosulphate
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -35
score = 4.56744
sequence = AATACCTTAGTATTTATATCGGAAAAG

Gene: SE1646: putative transporter for thiosulphate
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -38
score = 4.80801
sequence = TAAAACTTACTAACATTATCGGAAAAG

Gene: Sca_1551: putative transporter for thiosulphate
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0987: putative transporter for thiosulphate
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -37
score = 5.12404
sequence = TTAATCTTATTGATTTTATCGGGAAAG

Gene: SSP0834: putative transporter for thiosulphate
*
Macrococcus caseolyticus JCSC5402

Site:
position = -40
score = 5.764
sequence = TATTTCTTACTAAATCTATCGGAATTA

Gene: MCCL_0379: putative transporter for thiosulphate
putative transporter for thiosulphate
 
CRON 6.
SA0198
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -77
score = 4.77743
sequence = TAATCTTGAGTAGATTACTATGATATA

Gene: SA0198: oligopeptide transport ATP-binding protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
oligopeptide transport ATP-binding protein
 
CRON 7.
SA0165
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -59
score = 4.93951
sequence = GTAATCCGATAAGAATTATAGTAATAT

Gene: SA0165: hypothetical protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -69
score = 4.79243
sequence = CATATCCTTGTAATCTGATAAGATTTA

Gene: SSP0460: hypothetical protein
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
 
CRON 8.
metN2
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -42
score = 5.75824
sequence = TTATTCCTAGTGGATTAATAAGAATTT

Gene: SA0420: methionine ABC transporter paralog, ATP-binding protein MetN2
*
Staphylococcus capitis SK14

Site:
position = -43
score = 5.39689
sequence = ATATTCAGATAAGTATAATCAGAATTG

Gene: STACA0001_1483: methionine ABC transporter paralog, ATP-binding protein MetN2
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -42
score = 5.26907
sequence = ATATTCAGATAATTTTAATCGGAAATT

Gene: SE2322: methionine ABC transporter paralog, ATP-binding protein MetN2
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2191: methionine ABC transporter paralog, ATP-binding protein MetN2
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0417: methionine ABC transporter paralog, ATP-binding protein MetN2
methionine ABC transporter paralog, ATP-binding protein MetN2
metP2
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0421: methionine ABC transporter paralog, permease protein MetP2
 
Staphylococcus capitis SK14

Gene: STACA0001_1484: methionine ABC transporter paralog, permease protein MetP2
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2321: methionine ABC transporter paralog, permease protein MetP2
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2190: methionine ABC transporter paralog, permease protein MetP2
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0418: methionine ABC transporter paralog, permease protein MetP2
methionine ABC transporter paralog, permease protein MetP2
metQ2
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0422: methionine ABC transporter paralog, substrate-binding protein MetQ2
 
Staphylococcus capitis SK14

Gene: STACA0001_1485: methionine ABC transporter paralog, substrate-binding protein MetQ2
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2320: methionine ABC transporter paralog, substrate-binding protein MetQ2
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2189: methionine ABC transporter paralog, substrate-binding protein MetQ2
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0419: methionine ABC transporter paralog, substrate-binding protein MetQ2
methionine ABC transporter paralog, substrate-binding protein MetQ2
 
CRON 9.
mccA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -88
score = 5.82057
sequence = TAATTCTTATCTGAAAAGTAAGAATTA

Gene: SA0418: cystathionine beta-synthase
*
Staphylococcus capitis SK14

Site:
position = -96
score = 5.37115
sequence = TAATTCATACCTGATAAGTAAGAATTT

Gene: STACA0001_1480: cystathionine beta-synthase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -96
score = 5.70436
sequence = TAATTCATATCTGATAAGTAAGAATTA

Gene: SE2324: cystathionine beta-synthase
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -92
score = 5.5993
sequence = TAATCCATATCAGTATAGTAGGAATAA

Gene: Sca_0086: cystathionine beta-synthase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -109
score = 5.42572
sequence = TAATTCATAGTGATTGAGTAAGAATTA

Gene: SH2549: cystathionine beta-synthase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -57
score = 5.03317
sequence = TAATTCTTATCGGTATAGTAAGGTATT

Site:
position = -144
score = 5.06379
sequence = GTATGCTTACTGAAAAAGTAGGAATTA

Gene: SSP0252: cystathionine beta-synthase
*
Macrococcus caseolyticus JCSC5402

Site:
position = -46
score = 5.58334
sequence = TAATCCCGAGTTATCTGATAAGAATAA

Gene: MCCL_1789: cystathionine beta-synthase
cystathionine beta-synthase
mccB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0419: cystathionine gamma-lyase
 
Staphylococcus capitis SK14

Gene: STACA0001_1481: cystathionine gamma-lyase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2323: cystathionine gamma-lyase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0087: cystathionine gamma-lyase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2548: cystathionine gamma-lyase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0253: cystathionine gamma-lyase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1790: cystathionine gamma-lyase
cystathionine gamma-lyase
luxS
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -244
score = 4.75591
sequence = GAATTATTACTTATTCTATCGGTTTTA

Gene: SA1936: S-ribosylhomocysteinase
*
Staphylococcus capitis SK14

Site:
position = -193
score = 5.49013
sequence = TAATTATTACTTATTCTATCGGAATAA

Gene: STACA0001_0838: S-ribosylhomocysteinase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -182
score = 5.57936
sequence = TAATTATTACTTATTTTATCGGATTTA

Gene: SE1732: S-ribosylhomocysteinase
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -110
score = 4.67294
sequence = TTATCCCGAGTAAACTTATCAACTTAA

Gene: Sca_1637: S-ribosylhomocysteinase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -182
score = 5.57936
sequence = TAATTATTACTTATTTTATCGGATTTA

Gene: SH0901: S-ribosylhomocysteinase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -159
score = 5.13983
sequence = TAATTATTACTTATTCTATCGGGTTTA

Gene: SSP0751: S-ribosylhomocysteinase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1791: S-ribosylhomocysteinase
S-ribosylhomocysteinase
 
CRON 10.
cysK
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -55
score = 5.08397
sequence = TATATCCGATAAATAAACTAAGATTTC

Gene: SA0471: cysteine synthase
*
Staphylococcus capitis SK14

Site:
position = -57
score = 4.89394
sequence = TATATCCGATAGGAAAACTAAGTTTTA

Gene: STACA0001_2088: cysteine synthase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -58
score = 4.8227
sequence = TATATCCGATAGAAAAACTAAGTATTG

Gene: SE2270: cysteine synthase
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -143
score = 4.44308
sequence = GATATCCGATGAAATAGCTAAGATATA

Gene: Sca_0164: cysteine synthase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -56
score = 4.94506
sequence = TATATCCGATAGAAAAACTAAGTTTTA

Gene: SH2497: cysteine synthase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -55
score = 5.1095
sequence = TATATCCGATTGAAAAAGTAGGTTTTA

Gene: SSP2243: cysteine synthase
*
Macrococcus caseolyticus JCSC5402

Site:
position = -50
score = 5.36043
sequence = TAAATCCGATAAGCGTAATAAGAATAA

Gene: MCCL_1900: cysteine synthase
cysteine synthase
 
CRON 11.
cysJ
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -257
score = 4.71125
sequence = TAATAAATAGTAAATAAATAAAAAATA

Gene: SA2413: sulfite reductase [NADPH] flavoprotein, alpha-component
*
Staphylococcus capitis SK14

Site:
position = -246
score = 4.71748
sequence = TAAAGCATAGTATTCCGATAAGATATA

Gene: STACA0001_1811: sulfite reductase [NADPH] flavoprotein, alpha-component
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -273
score = 4.71837
sequence = CAAAACATAGTATTCCGATAAGAAATA

Gene: SE2180: sulfite reductase [NADPH] flavoprotein, alpha-component
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -52
score = 5.94771
sequence = TAATTCCTACTAAAAAACTAAGAATAA

Site:
position = -134
score = 5.42667
sequence = TAATTCTTAGTAAACCTATTGGAATTA

Gene: Sca_0059: sulfite reductase [NADPH] flavoprotein, alpha-component
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -152
score = 4.51928
sequence = TAAAACATAGTATTCTGATATGTTTTG

Gene: SH0414: sulfite reductase [NADPH] flavoprotein, alpha-component
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -152
score = 4.52675
sequence = AATAACCTAGTATTCGTATCGGAAATA

Site:
position = -58
score = 4.58672
sequence = TTAAACCTATTTAGACAATAATTATAA

Gene: SSP2408: sulfite reductase [NADPH] flavoprotein, alpha-component
 
Macrococcus caseolyticus JCSC5402
sulfite reductase [NADPH] flavoprotein, alpha-component
cysI
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14

Gene: STACA0001_1810: sulfite reductase (NADPH) hemoprotein, beta-component
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2179: sulfite reductase (NADPH) hemoprotein, beta-component
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0060: sulfite reductase (NADPH) hemoprotein, beta-component
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0415: sulfite reductase (NADPH) hemoprotein, beta-component
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2407: sulfite reductase (NADPH) hemoprotein, beta-component
 
Macrococcus caseolyticus JCSC5402
sulfite reductase (NADPH) hemoprotein, beta-component
cysG
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14

Gene: STACA0001_1809: uroporphyrin-III C-methyltransferase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2178: uroporphyrin-III C-methyltransferase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0061: uroporphyrin-III C-methyltransferase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0416: uroporphyrin-III C-methyltransferase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2406: uroporphyrin-III C-methyltransferase
 
Macrococcus caseolyticus JCSC5402
uroporphyrin-III C-methyltransferase
SSP2405
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2405: sirohydrochlorin ferrochelatase
 
Macrococcus caseolyticus JCSC5402
sirohydrochlorin ferrochelatase
sirC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2412: Precorrin-2 dehydrogenase
 
Staphylococcus capitis SK14

Gene: STACA0001_1808: Precorrin-2 dehydrogenase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2177: Precorrin-2 dehydrogenase
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0417: Precorrin-2 dehydrogenase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2404: Precorrin-2 dehydrogenase
 
Macrococcus caseolyticus JCSC5402
Precorrin-2 dehydrogenase
ytnM
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14

Gene: STACA0001_1807: conserved membrane protein YtnM
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2176: conserved membrane protein YtnM
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -105
score = 5.35107
sequence = TAAATCCTTGTAAACCAATAAGAATAA

Gene: Sca_0062: conserved membrane protein YtnM
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0418: conserved membrane protein YtnM
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2403: conserved membrane protein YtnM
 
Macrococcus caseolyticus JCSC5402
conserved membrane protein YtnM
cysD
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14

Gene: STACA0001_1806: sulfate adenylyltransferase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2175: sulfate adenylyltransferase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0063: sulfate adenylyltransferase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -48
score = 4.87171
sequence = TAAAACCGAGTAAACTAATCTAATTAA

Gene: SH0419: sulfate adenylyltransferase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2402: sulfate adenylyltransferase
 
Macrococcus caseolyticus JCSC5402
sulfate adenylyltransferase
cysC
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14

Gene: STACA0001_1805: adenylylsulfate kinase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2174: adenylylsulfate kinase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0064: adenylylsulfate kinase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0420: adenylylsulfate kinase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2401: adenylylsulfate kinase
 
Macrococcus caseolyticus JCSC5402
adenylylsulfate kinase
cysH
 
Staphylococcus aureus subsp. aureus N315
*
Staphylococcus capitis SK14

Site:
position = -71
score = 5.50752
sequence = TTATTCTGACAATTCAGATAGGAATTT

Gene: STACA0001_1812: phosphoadenosine phosphosulfate reductase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -68
score = 4.98385
sequence = TTATTCTGACAATTCTGATATGTTTTG

Gene: SE2181: phosphoadenosine phosphosulfate reductase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0058: phosphoadenosine phosphosulfate reductase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -68
score = 5.56749
sequence = TTATTCTGACAATTCTGATAGGTATTA

Gene: SH0413: phosphoadenosine phosphosulfate reductase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2409: phosphoadenosine phosphosulfate reductase
 
Macrococcus caseolyticus JCSC5402
phosphoadenosine phosphosulfate reductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD