Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RspR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 1 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043 8 1
Hahella chejuensis KCTC 2396
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Cellvibrio japonicus Ueda107
Marinobacter aqueolei
Marinobacter sp. ELB17
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rspR
 
Alcanivorax borkumensis SK2
*
Chromohalobacter salexigens DSM 3043

Site:
position = -46
score = 6.20975
sequence = CCAACTACCATACTAGTCAG

Gene: Csal_2973: Transcriptional regulator for L-gulonate utilization, GntR family
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
Transcriptional regulator for L-gulonate utilization, GntR family
rspA
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2974: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0037: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
rspB
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2975: L-gulonate dehydrogenase, COG1063 family
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0038: L-gulonate dehydrogenase, COG1063 family
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
L-gulonate dehydrogenase, COG1063 family
rspP
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2976: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0043: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
rspQ
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2977: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0044: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
rspM
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2978: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0045: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
rspD
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2979: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
D-mannonate oxidoreductase (EC 1.1.1.57)
uxuA
 
Alcanivorax borkumensis SK2
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2980: Mannonate dehydratase (EC 4.2.1.8)
 
Hahella chejuensis KCTC 2396
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
Mannonate dehydratase (EC 4.2.1.8)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD