Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RspR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895 7 2
Edwardsiella tarda EIB202
Enterobacter sp. 638 4 1
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043 5 1
Escherichia coli str. K-12 substr. MG1655 2 1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 3 2
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2 2 1
Serratia proteamaculans 568 5 1
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rspA
*
Citrobacter koseri ATCC BAA-895

Site:
position = -70
score = 5.76572
sequence = TATACTTGTATGGTAGTAGT

Gene: CKO_01575: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
 
Edwardsiella tarda EIB202
*
Enterobacter sp. 638

Site:
position = -70
score = 5.59139
sequence = AATACTTGTATGGTAGTAGC

Gene: Ent638_1932: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
 
Erwinia amylovora ATCC 49946
*
Erwinia carotovora subsp. atroseptica SCRI1043

Site:
position = -37
score = 5.34206
sequence = TATACTTGTATGGTAGTCAG

Gene: ECA0917: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
*
Escherichia coli str. K-12 substr. MG1655

Site:
position = -70
score = 5.82324
sequence = TATACTTGTATGGTAGTAGC

Gene: b1581: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
*
Salmonella typhimurium LT2

Site:
position = -69
score = 5.82324
sequence = TATACTTGTATGGTAGTAGC

Gene: STM1505: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
*
Serratia proteamaculans 568

Site:
position = -74
score = 5.2965
sequence = CATACTTGTATGGTAGTTAG

Gene: Spro_3563: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
 
Yersinia pestis KIM
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
rspB
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01574: L-gulonate dehydrogenase, COG1063 family
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_1933: L-gulonate dehydrogenase, COG1063 family
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0918: L-gulonate dehydrogenase, COG1063 family
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1580: L-gulonate dehydrogenase, COG1063 family
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -49
score = 5.30871
sequence = CATACTTGTATGGTAATAAA

Gene: KPN_03621: L-gulonate dehydrogenase, COG1063 family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM1506: L-gulonate dehydrogenase, COG1063 family
 
Serratia proteamaculans 568

Gene: Spro_3564: L-gulonate dehydrogenase, COG1063 family
 
Yersinia pestis KIM
L-gulonate dehydrogenase, COG1063 family
rspC
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01573: Putative gulonate transporter, MFS superfamily, COG2271 family
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_1934: Putative gulonate transporter, MFS superfamily, COG2271 family
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0919: Putative gulonate transporter, MFS superfamily, COG2271 family
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_03622: Putative gulonate transporter, MFS superfamily, COG2271 family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568

Gene: Spro_3565: Putative gulonate transporter, MFS superfamily, COG2271 family
 
Yersinia pestis KIM
Putative gulonate transporter, MFS superfamily, COG2271 family
rspD
 2
Citrobacter koseri ATCC BAA-895

Gene: CKO_03733: D-mannonate oxidoreductase (EC 1.1.1.57)

Gene: CKO_01572: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_1935: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0920: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1542: D-mannonate oxidoreductase (EC 1.1.1.57)
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Site:
position = -132
score = 5.24367
sequence = TCTTCTTGTATGGTAGTTGA

Gene: KPN_01587: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM1508: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Serratia proteamaculans 568

Gene: Spro_3566: D-mannonate oxidoreductase (EC 1.1.1.57)
 
Yersinia pestis KIM
D-mannonate oxidoreductase (EC 1.1.1.57)
rspR
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_01570: Transcriptional regulator for L-gulonate utilization, GntR family
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638

Gene: Ent638_1938: Transcriptional regulator for L-gulonate utilization, GntR family
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043

Gene: ECA0921: Transcriptional regulator for L-gulonate utilization, GntR family
 
Escherichia coli str. K-12 substr. MG1655

Gene: b1540: Transcriptional regulator for L-gulonate utilization, GntR family
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Gene: KPN_01589: Transcriptional regulator for L-gulonate utilization, GntR family
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2

Gene: STM1510: Transcriptional regulator for L-gulonate utilization, GntR family
 
Serratia proteamaculans 568

Gene: Spro_3567: Transcriptional regulator for L-gulonate utilization, GntR family
 
Yersinia pestis KIM
Transcriptional regulator for L-gulonate utilization, GntR family
uxaC2
*
Citrobacter koseri ATCC BAA-895

Site:
position = -133
score = 5.60565
sequence = TACACTTGTATGGTAGTAGA

Gene: CKO_03735: Uronate isomerase (EC 5.3.1.12)
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Uronate isomerase (EC 5.3.1.12)
COG2211
 
Citrobacter koseri ATCC BAA-895

Gene: CKO_03734: Oligogalacturonide transporter
 
Edwardsiella tarda EIB202
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320
 
Salmonella typhimurium LT2
 
Serratia proteamaculans 568
 
Yersinia pestis KIM
Oligogalacturonide transporter
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD