Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CggR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-diphosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 6 1
Staphylococcus capitis SK14 6 1
Staphylococcus epidermidis ATCC 12228 6 1
Staphylococcus carnosus subsp. carnosus TM300 6 1
Staphylococcus haemolyticus JCSC1435 6 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 6 1
Macrococcus caseolyticus JCSC5402 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cggR
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -85
score = 6.88081
sequence = TTTTGTCCCACGCGGGACTTAA

Gene: SA0726: Transcriptional regulator of central glycolytic gene, SorC family
*
Staphylococcus capitis SK14

Site:
position = -91
score = 6.73737
sequence = TTTTGTCCCAGGTGGGACTTAA

Gene: STACA0001_0256: Transcriptional regulator of central glycolytic gene, SorC family
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -91
score = 6.73737
sequence = TTTTGTCCCAGGTGGGACTTAA

Gene: SE0556: Transcriptional regulator of central glycolytic gene, SorC family
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -77
score = 6.71331
sequence = TTTTGTCCCACCCGGGACTTAA

Gene: Sca_0423: Transcriptional regulator of central glycolytic gene, SorC family
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -81
score = 6.74809
sequence = TTTTGTCCCGCGCGGGACACAA

Gene: SH2114: Transcriptional regulator of central glycolytic gene, SorC family
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -78
score = 5.92532
sequence = TTTTGTCCTGCTAGGGACGTAA

Gene: SSP1917: Transcriptional regulator of central glycolytic gene, SorC family
*
Macrococcus caseolyticus JCSC5402

Site:
position = -47
score = 5.89941
sequence = TTTTGACCCGAGTGGGACGAAT

Gene: MCCL_0520: Transcriptional regulator of central glycolytic gene, SorC family
Transcriptional regulator of central glycolytic gene, SorC family
gap
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0727: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Staphylococcus capitis SK14

Gene: STACA0001_0255: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0557: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0424: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2113: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1916: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0521: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
pgk
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0728: Phosphoglycerate kinase (EC 2.7.2.3)
 
Staphylococcus capitis SK14

Gene: STACA0001_0254: Phosphoglycerate kinase (EC 2.7.2.3)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0558: Phosphoglycerate kinase (EC 2.7.2.3)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0425: Phosphoglycerate kinase (EC 2.7.2.3)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2112: Phosphoglycerate kinase (EC 2.7.2.3)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1915: Phosphoglycerate kinase (EC 2.7.2.3)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0522: Phosphoglycerate kinase (EC 2.7.2.3)
Phosphoglycerate kinase (EC 2.7.2.3)
tpiA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0729: Triosephosphate isomerase (EC 5.3.1.1)
 
Staphylococcus capitis SK14

Gene: STACA0001_0253: Triosephosphate isomerase (EC 5.3.1.1)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0559: Triosephosphate isomerase (EC 5.3.1.1)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0426: Triosephosphate isomerase (EC 5.3.1.1)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2111: Triosephosphate isomerase (EC 5.3.1.1)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1914: Triosephosphate isomerase (EC 5.3.1.1)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0523: Triosephosphate isomerase (EC 5.3.1.1)
Triosephosphate isomerase (EC 5.3.1.1)
pgm
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0730: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Staphylococcus capitis SK14

Gene: STACA0001_0252: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0560: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0427: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2110: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1913: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0524: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
eno
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0731: Enolase (EC 4.2.1.11)
 
Staphylococcus capitis SK14

Gene: STACA0001_0251: Enolase (EC 4.2.1.11)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0561: Enolase (EC 4.2.1.11)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0428: Enolase (EC 4.2.1.11)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2109: Enolase (EC 4.2.1.11)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1912: Enolase (EC 4.2.1.11)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0525: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD