Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BirA - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: BirA
Regulation mode: repressor
Biological process: Biotin biosynthesis
Effector: Biotin
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 21 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 12 3
Staphylococcus capitis SK14 8 3
Staphylococcus epidermidis ATCC 12228 12 4
Staphylococcus carnosus subsp. carnosus TM300 7 4
Staphylococcus haemolyticus JCSC1435 7 3
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 6 2
Macrococcus caseolyticus JCSC5402 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yhfT
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -48
score = 7.06964
sequence = AATGTTAACAAGATGTATTTTAAAGTTTACATT

Gene: SA0533: putative long chain fatty acid-CoA ligase
*
Staphylococcus capitis SK14

Site:
position = -43
score = 7.17092
sequence = AATGTTAACATATTTATAAATATAGTTTACATA

Gene: STACA0001_0458: putative long chain fatty acid-CoA ligase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -44
score = 7.05411
sequence = AATGTAAACATAATTATATAAAGTGTTTACAAA

Gene: SE0344: putative long chain fatty acid-CoA ligase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2089: putative long chain fatty acid-CoA ligase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -55
score = 7.56508
sequence = AATGTTAACATAATATAAAATAAAGTTAACATT

Gene: SH2418: putative long chain fatty acid-CoA ligase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -49
score = 6.58307
sequence = AATGTTAACATATTTGTTATGAAGGTTAACAAA

Gene: SSP2146: putative long chain fatty acid-CoA ligase
 
Macrococcus caseolyticus JCSC5402
putative long chain fatty acid-CoA ligase
SE0345
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0345: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
yhfS
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0534: putative acetyl-CoA c-acetyltransferase
 
Staphylococcus capitis SK14

Gene: STACA0001_0457: putative acetyl-CoA c-acetyltransferase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0346: putative acetyl-CoA c-acetyltransferase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2088: putative acetyl-CoA c-acetyltransferase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2417: putative acetyl-CoA c-acetyltransferase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2145: putative acetyl-CoA c-acetyltransferase
 
Macrococcus caseolyticus JCSC5402
putative acetyl-CoA c-acetyltransferase
SA0535
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0535: hypothetical protein
 
Staphylococcus capitis SK14

Gene: STACA0001_0456: hypothetical protein
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0347: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2087: hypothetical protein
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2416: hypothetical protein
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2144: hypothetical protein
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
SA0536
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0536: hypothetical protein
 
Staphylococcus capitis SK14

Gene: STACA0001_0455: hypothetical protein
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0348: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2415: hypothetical protein
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP2143: hypothetical protein
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
 
CRON 2.
pycA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0963: pyruvate carboxylase
 
Staphylococcus capitis SK14

Gene: STACA0001_2249: pyruvate carboxylase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0813: pyruvate carboxylase
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -367
score = 7.19291
sequence = AATGTAAACTTAAAAATAAATAAAATTAACAAT

Gene: Sca_0740: pyruvate carboxylase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1838: pyruvate carboxylase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1675: pyruvate carboxylase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0729: pyruvate carboxylase
pyruvate carboxylase
 
CRON 3.
bioY
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -75
score = 7.50757
sequence = ATTGTAAACTTTTCATTTCTTAAAGTTTACAAT

Gene: SA2077: Substrate-specific component BioY of biotin ECF transporter
*
Staphylococcus capitis SK14

Site:
position = -70
score = 7.78149
sequence = TATGTAAACTTTTTATTTCTTAAAGTTTACATT

Gene: STACA0001_1211: Substrate-specific component BioY of biotin ECF transporter
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -70
score = 6.9213
sequence = ATTGTAAACTTTCCATTCATAAAAGTTTACAAG

Gene: SE1856: Substrate-specific component BioY of biotin ECF transporter
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -75
score = 7.28465
sequence = AATGTAAACTTTTAGTAAATTCAAGTTAACAAT

Gene: Sca_1775: Substrate-specific component BioY of biotin ECF transporter
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -69
score = 8.17293
sequence = AATGTAAACTTTTTATTTTATAAAGTTTACATT

Gene: SH0770: Substrate-specific component BioY of biotin ECF transporter
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -67
score = 8.11648
sequence = AATGTAAACTTTTTATTTTTTAAAGTTTACATT

Gene: SSP0625: Substrate-specific component BioY of biotin ECF transporter
*
Macrococcus caseolyticus JCSC5402

Site:
position = -75
score = 6.67416
sequence = ATTGTTAACTTTTTGTACTAAAAGGTTAACGAA

Gene: MCCL_0134: Substrate-specific component BioY of biotin ECF transporter
Substrate-specific component BioY of biotin ECF transporter
SA2076
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2076: putative acetyltransferase
 
Staphylococcus capitis SK14

Gene: STACA0001_1212: putative acetyltransferase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1855: putative acetyltransferase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1774: putative acetyltransferase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0771: putative acetyltransferase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0626: putative acetyltransferase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1694: putative acetyltransferase
putative acetyltransferase
 
CRON 4.
bioD
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -55
score = 7.94585
sequence = AATGTAAACTTATTAATTATAAAAGTTTACATT

Gene: SA2215: Dethiobiotin synthetase (EC 6.3.3.3)
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -55
score = 7.7403
sequence = AATGTAAACTTTAAAATGTAATAAGTTTACATT

Gene: SE0179: Dethiobiotin synthetase (EC 6.3.3.3)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2224: Dethiobiotin synthetase (EC 6.3.3.3)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Dethiobiotin synthetase (EC 6.3.3.3)
bioA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2214: Adenosylmethionine-8-amino-7-oxononanoate aminotransferase (EC 2.6.1.62)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0180: Adenosylmethionine-8-amino-7-oxononanoate aminotransferase (EC 2.6.1.62)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2223: Adenosylmethionine-8-amino-7-oxononanoate aminotransferase (EC 2.6.1.62)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Adenosylmethionine-8-amino-7-oxononanoate aminotransferase (EC 2.6.1.62)
bioB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2213: Biotin synthase (EC 2.8.1.6)
*
Staphylococcus capitis SK14

Site:
position = -87
score = 7.99118
sequence = AATGTAAACTTATAAATATATAAAGTTTACATT

Gene: STACA0001_0034: Biotin synthase (EC 2.8.1.6)
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -110
score = 7.88128
sequence = AATGTAAACTTATAAATATATAAAGTTTACAAT

Gene: SE0234: Biotin synthase (EC 2.8.1.6)
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -63
score = 7.35149
sequence = AATGTTAACTATATAAAAAAATAAGTTAACAAT

Gene: Sca_2002: Biotin synthase (EC 2.8.1.6)
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -75
score = 7.96501
sequence = AATGTAAACTTATTTATATATAAAGTTTACATT

Gene: SH0269: Biotin synthase (EC 2.8.1.6)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
*
Macrococcus caseolyticus JCSC5402

Site:
position = -76
score = 6.75088
sequence = ATTGTTAACTTATATTCAAAATTAGTTTACAAT

Gene: MCCL_0376: Biotin synthase (EC 2.8.1.6)
Biotin synthase (EC 2.8.1.6)
bioF
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2212: 8-amino-7-oxononanoate synthase (EC 2.3.1.47)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0181: 8-amino-7-oxononanoate synthase (EC 2.3.1.47)
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
8-amino-7-oxononanoate synthase (EC 2.3.1.47)
bioW
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2211: Pimeloyl-CoA synthase (EC 6.2.1.14)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0182: Pimeloyl-CoA synthase (EC 6.2.1.14)
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Pimeloyl-CoA synthase (EC 6.2.1.14)
bioX
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2210: hypothetical protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
bioY
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -73
score = 7.97202
sequence = AATGTAAACTTATAAAAATTAAAAGTTTACATT

Gene: Sca_2225: Substrate-specific component BioY of biotin ECF transporter
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Substrate-specific component BioY of biotin ECF transporter
SA2076
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14

Gene: STACA0001_0035: hypothetical protein
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD