Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArsR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate; Arsenite
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 5 2
Staphylococcus capitis SK14 3 1
Staphylococcus epidermidis ATCC 12228 8 2
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435 12 3
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 11 3
Macrococcus caseolyticus JCSC5402 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
arsD
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -49
score = 6.41042
sequence = TATATAGATGTTAGTCTATAAT

Site:
position = -65
score = 5.94069
sequence = AACATAGACATTAATCTATATA

Gene: SE0138: arsenical resistance operon trans-acting ArsD
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -213
score = 5.30959
sequence = AATATAAATCAATATCTATATT

Site:
position = -65
score = 5.13435
sequence = AACATAGACACCAATCTATATA

Site:
position = -49
score = 6.66533
sequence = TATATAGATGTTAATCTATAAT

Gene: SH0112: arsenical resistance operon trans-acting ArsD
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -49
score = 6.12752
sequence = TATATAGATGTTAATCTATGGT

Site:
position = -65
score = 5.79358
sequence = TACATAGACACTAATCTATATA

Gene: SSPP119: arsenical resistance operon trans-acting ArsD
 
Macrococcus caseolyticus JCSC5402
arsenical resistance operon trans-acting ArsD
arsA
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0137: arsenite-transporting ATPase
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0111: arsenite-transporting ATPase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSPP118: arsenite-transporting ATPase
 
Macrococcus caseolyticus JCSC5402
arsenite-transporting ATPase
SSPP117
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSPP117: putative dehydrogenase
 
Macrococcus caseolyticus JCSC5402
putative dehydrogenase
arsR
*2
Staphylococcus aureus subsp. aureus N315

Site:
position = -56
score = 6.18229
sequence = AATATAGACATTCATCTATATA

Site:
position = -40
score = 6.8565
sequence = TATATAGATGATAATCTATTTA

Gene: SA1591: arsenical resistance operon repressor

Site:
position = -41
score = 6.7219
sequence = TATATAGATGTTAATCTATTTA

Site:
position = -57
score = 6.07528
sequence = AACATAGACAATAATCTATATA

Gene: SAP016: arsenical resistance operon repressor
*
Staphylococcus capitis SK14

Site:
position = -42
score = 6.79992
sequence = TATATAGATGATAATCTATAAT

Site:
position = -58
score = 5.95417
sequence = TATATAGATATTTGTCTATATA

Gene: STACA0001_1318: arsenical resistance operon repressor
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0136: arsenical resistance operon repressor
 
Staphylococcus carnosus subsp. carnosus TM300
*2
Staphylococcus haemolyticus JCSC1435

Gene: SH0110: arsenical resistance operon repressor

Site:
position = -42
score = 6.79992
sequence = TATATAGATGATAATCTATAAT

Gene: SH0103: arsenical resistance operon repressor
*2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -40
score = 6.54635
sequence = TATATAGATGTTAGTCTATGTA

Site:
position = -56
score = 5.37596
sequence = AATATAGACACCAATCTATATA

Gene: SSP2384: arsenical resistance operon repressor

Gene: SSPP116: arsenical resistance operon repressor
*
Macrococcus caseolyticus JCSC5402

Site:
position = -46
score = 6.80126
sequence = TATATAGATGTTAATCTATGTA

Site:
position = -62
score = 5.61829
sequence = TATATAGACACTTATCTATATA

Gene: MCCL_1484: arsenical resistance operon repressor
arsenical resistance operon repressor
arsB
 2
Staphylococcus aureus subsp. aureus N315

Gene: SA1592: arsenic efflux pump protein

Gene: SAP017: arsenic efflux pump protein
 
Staphylococcus capitis SK14

Gene: STACA0001_1319: arsenical pump membrane protein
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0135: arsenic efflux pump protein
 
Staphylococcus carnosus subsp. carnosus TM300
 2
Staphylococcus haemolyticus JCSC1435

Gene: SH0109: arsenic efflux pump protein

Gene: SH0102: arsenical pump membrane protein
 2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSPP115: arsenic efflux pump protein

Gene: SSP2383: arsenic efflux pump protein
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1485: arsenic efflux pump protein
arsenic efflux pump protein
arsC
 
Staphylococcus aureus subsp. aureus N315

Gene: SAP018: arsenate reductase
 
Staphylococcus capitis SK14

Gene: STACA0001_1320: arsenate reductase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0134: arsenate reductase
 
Staphylococcus carnosus subsp. carnosus TM300
 2
Staphylococcus haemolyticus JCSC1435

Gene: SH0108: arsenate reductase

Gene: SH0101: arsenate reductase
 2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSPP114: arsenate reductase

Gene: SSP1633: arsenate reductase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1486: arsenate reductase
arsenate reductase
 
CRON 2.
SH0113
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -90
score = 5.30959
sequence = AATATAGATATTGATTTATATT

Site:
position = -238
score = 5.13435
sequence = TATATAGATTGGTGTCTATGTT

Site:
position = -254
score = 6.66533
sequence = ATTATAGATTAACATCTATATA

Gene: SH0113: hypothetical protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -241
score = 5.79358
sequence = TATATAGATTAGTGTCTATGTA

Site:
position = -257
score = 6.12752
sequence = ACCATAGATTAACATCTATATA

Gene: SSPP120: hypothetical protein
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
arsR3
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -332
score = 4.78764
sequence = AATATATATATTGATTTATATT

Site:
position = -477
score = 5.94069
sequence = TATATAGATTAATGTCTATGTT

Site:
position = -493
score = 6.41042
sequence = ATTATAGACTAACATCTATATA

Gene: SE0139: arsenical resistance operon repressor-like protein
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0114: hypothetical protein
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSPP121: arsenical resistance operon repressor-like protein
 
Macrococcus caseolyticus JCSC5402
arsenical resistance operon repressor-like protein
SE0140
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0140: putative permease
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0115: putative permease
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSPP122: putative permease
 
Macrococcus caseolyticus JCSC5402
putative permease
SE0141
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0141: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0116: hypothetical protein
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD