Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium abscessus ATCC 19977 13 4
Mycobacterium smegmatis str. MC2 155
Mycobacterium tuberculosis H37Rv
Mycobacterium avium 104
Mycobacterium marinum M
Mycobacterium leprae TN
Mycobacterium flavescens PYR-GCK
Mycobacterium vanbaalenii PYR-1
Mycobacterium sp. JLS
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaZ
*
Mycobacterium abscessus ATCC 19977

Site:
position = -108
score = 4.8959
sequence = ACTGACCGTTCGGTCGGCCACA

Site:
position = -35
score = 5.42127
sequence = ACCGAACGAATGGACGGTTGGT

Gene: MAB_0900c: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
ethD
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0899c: Possible ethyl tert-butyl ether degradation protein EthD
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Possible ethyl tert-butyl ether degradation protein EthD
 
CRON 2.
paaA
*
Mycobacterium abscessus ATCC 19977

Site:
position = -37
score = 6.13347
sequence = AATAACCGAACATTCGGTCGGT

Site:
position = -33
score = 4.50201
sequence = ACCGAACATTCGGTCGGTAATC

Gene: MAB_0906: Phenylacetate-CoA oxygenase, PaaA subunit
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0907: Phenylacetate-CoA oxygenase, PaaB subunit
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0908: Phenylacetate-CoA oxygenase, PaaC subunit
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0909: Phenylacetate-CoA oxygenase, PaaD subunit
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0910: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaK
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0911: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
CRON 3.
paaR
*
Mycobacterium abscessus ATCC 19977

Site:
position = -92
score = 6.15351
sequence = AATAACCGATCGTTCGGTCGGT

Site:
position = -88
score = 4.67361
sequence = ACCGATCGTTCGGTCGGTTGTC

Gene: MAB_0901c: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Transcriptional regulator of phenylacetic acid degradation, TetR family
 
CRON 4.
paaJ
*
Mycobacterium abscessus ATCC 19977

Site:
position = -48
score = 4.67361
sequence = GACAACCGACCGAACGATCGGT

Site:
position = -44
score = 6.15351
sequence = ACCGACCGAACGATCGGTTATT

Gene: MAB_0902: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0903: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0904: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaG
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_0905: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium avium 104
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium vanbaalenii PYR-1
 
Mycobacterium sp. JLS
Enoyl-CoA hydratase (EC 4.2.1.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD