Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecalis V583 8 4
Enterococcus faecium DO 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntH
*2
Enterococcus faecalis V583

Site:
position = -57
score = 5.99056
sequence = ATTTTTAGGTGTGCCTAAAAGT

Gene: EF1901: Manganese transport protein, NRAMP family

Site:
position = -90
score = 6.63446
sequence = TATTTTAGGTGTACCTAAAATA

Gene: EF1057: Manganese transport protein, NRAMP family
 
Enterococcus faecium DO
Manganese transport protein, NRAMP family
 
CRON 2.
mntA
*2
Enterococcus faecalis V583

Site:
position = -78
score = 6.00761
sequence = AAATTTAGGCTTGACTAAAATA

Gene: EF0575: Manganese ABC transporter, ATP-binding protein

Site:
position = -88
score = 6.12999
sequence = GTATTTAGGTGCGCCTAAAAAT

Site:
position = -33
score = 5.75931
sequence = ATTTTAAGGCAAACCTAAAAAA

Gene: EF2074: Manganese ABC transporter, ATP-binding protein
*
Enterococcus faecium DO

Site:
position = -33
score = 5.93014
sequence = AAAGTTAGGTAAACCTAAAAAG

Gene: EfaeDRAFT_2039: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mntB
 2
Enterococcus faecalis V583

Gene: EF2075: Manganese ABC transporter, inner membrane permease protein

Gene: EF0576: Manganese ABC transporter, inner membrane permease protein
 
Enterococcus faecium DO

Gene: EfaeDRAFT_2038: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
mntC
 2
Enterococcus faecalis V583

Gene: EF0577: Manganese ABC transporter, periplasmic-binding protein

Gene: EF2076: Manganese ABC transporter, periplasmic-binding protein
 
Enterococcus faecium DO

Gene: EfaeDRAFT_2037: Manganese ABC transporter, periplasmic-binding protein
Manganese ABC transporter, periplasmic-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD