Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CzrA - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 2 1
Clostridium beijerincki NCIMB 8052 2 1
Clostridium botulinum A str. ATCC 3502 2 1
Clostridium butyricum 5521 2 1
Clostridium kluyveri DSM 555 1 1
Clostridium novyi NT 2 1
Clostridium perfringens ATCC 13124 2 1
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czrA
*
Clostridium acetobutylicum ATCC 824

Site:
position = -45
score = 7.38741
sequence = CATATGAACATATATTCATATG

Gene: CAC2242: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Clostridium beijerincki NCIMB 8052

Site:
position = -44
score = 6.91187
sequence = CGTATGAACAGATATTCATATG

Gene: Cbei_1448: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -68
score = 6.7498
sequence = CATATGAACAATTATTCATACG

Gene: CBO0477: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Clostridium butyricum 5521

Site:
position = -41
score = 7.14698
sequence = CATATGAACAGATGCTCATATG

Gene: CBY_3037: Transcriptional repressor of multiple metal-sensing, ArsR family
 2
Clostridium kluyveri DSM 555

Gene: CKL_3755: Transcriptional repressor of multiple metal-sensing, ArsR family

Gene: CKL_3732: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Clostridium novyi NT

Site:
position = -35
score = 7.07394
sequence = CATATGAATATATGTTCAAATG

Gene: NT01CX_1198: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Clostridium perfringens ATCC 13124

Site:
position = -49
score = 7.14698
sequence = CATATGAACAGATGCTCATATG

Gene: CPF_2588: Transcriptional repressor of multiple metal-sensing, ArsR family
 
Clostridium tetani E88
Transcriptional repressor of multiple metal-sensing, ArsR family
cadA
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2241: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1449: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO0478: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Clostridium butyricum 5521

Gene: CBY_3038: Cadmium-transporting ATPase (EC 3.6.3.3)
*
Clostridium kluyveri DSM 555

Site:
position = -159
score = 6.33438
sequence = CATATGAACAATAACTCATATG

Gene: CKL_2303: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Clostridium novyi NT

Gene: NT01CX_1199: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2587: Cadmium-transporting ATPase (EC 3.6.3.3)
 
Clostridium tetani E88

Gene: CTC01955: Cadmium-transporting ATPase (EC 3.6.3.3)
Cadmium-transporting ATPase (EC 3.6.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD