Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CzrA - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 4 1
Listeria monocytogenes EGD-e 4 1
Listeria seeligeri serovar 1/2b str. SLCC3954 4 1
Listeria welshimeri serovar 6b str. SLCC5334 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
czrA
*
Listeria innocua Clip11262

Site:
position = -42
score = 6.52468
sequence = CATATGAATATATGACCATATA

Gene: lin2636: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Listeria monocytogenes EGD-e

Site:
position = -43
score = 6.83625
sequence = CATATGAGTATATGAACATATA

Gene: lmo2493: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -43
score = 6.54304
sequence = CATATGAGTATATGAACATGTA

Gene: lse_2393: Transcriptional repressor of multiple metal-sensing, ArsR family
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -43
score = 6.83625
sequence = CATATGAGTATATGAACATATA

Gene: lwe2441: Transcriptional repressor of multiple metal-sensing, ArsR family
Transcriptional repressor of multiple metal-sensing, ArsR family
lin2635
 
Listeria innocua Clip11262

Gene: lin2635: Hypothetical protein
 
Listeria monocytogenes EGD-e

Gene: lmo2492: Hypothetical protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2392: Hypothetical protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2440: Hypothetical protein
Hypothetical protein
czcD
 
Listeria innocua Clip11262

Gene: lin2634: Cation efflux transporter
 
Listeria monocytogenes EGD-e

Gene: lmo2491: Cation efflux transporter
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2391: Cation efflux transporter
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2439: Cation efflux transporter
Cation diffusion facilitator family transporter
csbA
 
Listeria innocua Clip11262

Gene: lin2633: Hypothetical protein
 
Listeria monocytogenes EGD-e

Gene: lmo2490: Hypothetical protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_2390: Hypothetical protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe2438: Hypothetical protein
Hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD