Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EutR - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium abscessus ATCC 19977
Mycobacterium avium 104
Mycobacterium flavescens PYR-GCK
Mycobacterium leprae TN
Mycobacterium marinum M
Mycobacterium smegmatis str. MC2 155
Mycobacterium sp. JLS 6 2
Mycobacterium tuberculosis H37Rv
Mycobacterium vanbaalenii PYR-1 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG0121
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
*
Mycobacterium sp. JLS

Site:
position = -80
score = 4.89554
sequence = TATGTCATGAATGTTTCAAG

Site:
position = -69
score = 4.65572
sequence = TGTTTCAAGTTCTTTAAAAT

Gene: Mjls_0224: Predicted glutamine amidotransferase
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -86
score = 4.78052
sequence = TATGTCATAAATGTTTCAGC

Gene: Mvan_2921: Predicted glutamine amidotransferase
Predicted glutamine amidotransferase
eutR
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS

Gene: Mjls_0225: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2922: Transcriptional regulator of ethanolamine utilization, RpiR family
Transcriptional regulator of ethanolamine utilization, RpiR family
 
CRON 2.
eutB
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
*
Mycobacterium sp. JLS

Site:
position = -66
score = 4.65572
sequence = ATTTTAAAGAACTTGAAACA

Site:
position = -55
score = 4.89554
sequence = CTTGAAACATTCATGACATA

Gene: Mjls_0223: glutamine synthetase family protein
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -62
score = 4.78052
sequence = GCTGAAACATTTATGACATA

Gene: Mvan_2920: glutamine synthetase family protein
glutamine synthetase family protein
eutT
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS

Gene: Mjls_0222: Ethanolamine permease, APC family
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2919: Ethanolamine permease, APC family
Ethanolamine permease, APC family
Mvan_2918
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2918: small molecule metabolism; central intermediary metabolism; amino acids
small molecule metabolism; central intermediary metabolism; amino acids
PF04909
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium avium 104
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium sp. JLS

Gene: Mjls_0221: Amidohydrolase 2
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2917: Amidohydrolase 2
Amidohydrolase 2
COG1982
 
Mycobacterium abscessus ATCC 19977

Gene: MAB_2524: Arginine/lysine/ornithine decarboxylases
 
Mycobacterium avium 104

Gene: MAV_2031: Arginine/lysine/ornithine decarboxylases
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium leprae TN
 
Mycobacterium marinum M
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_0266: Arginine/lysine/ornithine decarboxylases
 
Mycobacterium sp. JLS

Gene: Mjls_0220: Arginine/lysine/ornithine decarboxylases
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_2916: Arginine/lysine/ornithine decarboxylases
Arginine/lysine/ornithine decarboxylases
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD