Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EutR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process:
Effector:
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD 3 2
Burkholderia glumae BGR1
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815
Burkholderia pseudomallei K96243
Burkholderia sp. 383 3 2
Burkholderia vietnamiensis G4 2 2
Burkholderia xenovorans LB400
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF01019
*
Burkholderia cepacia AMMD

Site:
position = -188
score = 5.02849
sequence = TGTGTAATAAAACAAACATT

Site:
position = -70
score = 5.54845
sequence = AATGTACTGTTCATTACATG

Gene: Bamb_4137: Gamma-glutamyltranspeptidase (EC 2.3.2.2)
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -216
score = 4.90768
sequence = TCTGTAATAAAACAAACATA

Site:
position = -100
score = 5.7142
sequence = AATGTATTGTTTATTACATG

Gene: Bcep18194_B0996: Gamma-glutamyltranspeptidase (EC 2.3.2.2)
*
Burkholderia vietnamiensis G4

Site:
position = -213
score = 4.84142
sequence = CGTGTAACGAATCAAACATT

Site:
position = -99
score = 5.5622
sequence = AATGTATCGTTCATTACATT

Gene: Bcep1808_5277: Gamma-glutamyltranspeptidase (EC 2.3.2.2)
 
Burkholderia xenovorans LB400
Gamma-glutamyltranspeptidase (EC 2.3.2.2)
PF00375
 
Burkholderia cepacia AMMD

Gene: Bamb_4136: C4-dicarboxylate transport protein
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B0997: C4-dicarboxylate transport protein
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
C4-dicarboxylate transport protein
 
CRON 2.
eutR
*
Burkholderia cepacia AMMD

Site:
position = -167
score = 5.02849
sequence = AATGTTTGTTTTATTACACA

Gene: Bamb_4138: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -167
score = 4.90768
sequence = TATGTTTGTTTTATTACAGA

Gene: Bcep18194_B0995: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Burkholderia vietnamiensis G4

Site:
position = -166
score = 4.84142
sequence = AATGTTTGATTCGTTACACG

Gene: Bcep1808_5278: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Burkholderia xenovorans LB400
Transcriptional regulator of ethanolamine utilization, RpiR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD