Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EutR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1 5 1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5 5 1
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
eutR
 
Azotobacter vinelandii AvOP
*
Pseudomonas aeruginosa PAO1

Site:
position = -83
score = 5.03645
sequence = AATGTAGTGAAAAAAACATT

Gene: PA5506: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Pseudomonas entomophila L48
*
Pseudomonas fluorescens Pf-5

Site:
position = -77
score = 5.51523
sequence = CATGTAGCGTCTATTACATA

Site:
position = -38
score = 4.39573
sequence = TATGAAATAAAAACGACATC

Gene: PFL_2247: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Transcriptional regulator of ethanolamine utilization, RpiR family
COG1335
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA5507: Amidases related to nicotinamidase
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2246: Amidases related to nicotinamidase
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Amidases related to nicotinamidase
eutB
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA5508: glutamine synthetase family protein
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2245: glutamine synthetase family protein
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
glutamine synthetase family protein
eutA
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA5509: putative N-formylglutamate amidohydrolase family protein
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2244: putative N-formylglutamate amidohydrolase family protein
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
putative N-formylglutamate amidohydrolase family protein
eutT
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1

Gene: PA5510: Ethanolamine permease, APC family
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2243: Ethanolamine permease, APC family
 
Pseudomonas mendocina ymp
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Ethanolamine permease, APC family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD