Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EutR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Alcanivorax borkumensis SK2
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043 8 2
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
eutA
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -64
score = 4.82138
sequence = TTTGAAAAAATATTGACACG

Gene: Csal_0675: N-formylglutamate amidohydrolase
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
N-formylglutamate amidohydrolase
eutQ
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0676: TRAP-type ethanolamine transport system, small permease component
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
TRAP-type ethanolamine transport system, small permease component
eutM
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0677: TRAP-type ethanolamine transport system, large permease component
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
TRAP-type ethanolamine transport system, large permease component
eutP
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0678: TRAP-type ethanolamine transport system, periplasmic component
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
TRAP-type ethanolamine transport system, periplasmic component
eutB
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0679: glutamine synthetase family protein
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
glutamine synthetase family protein
eutX
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0680: aldehyde dehydrogenase
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
aldehyde dehydrogenase
eutY
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0681: alcohol dehydrogenase
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
alcohol dehydrogenase
 
CRON 2.
eutR
 
Alcanivorax borkumensis SK2
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -84
score = 4.82138
sequence = CGTGTCAATATTTTTTCAAA

Gene: Csal_0674: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Marinomonas sp. MWYL1
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
Transcriptional regulator of ethanolamine utilization, RpiR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD