Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EutR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 8 2
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1 5 2
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42 6 2
Rhizobium leguminosarum bv. viciae 3841 6 2
Rhizobium sp. NGR234 6 2
Rhodopseudomonas palustris CGA009
Sinorhizobium meliloti 1021 6 2
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
eutR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -94
score = 5.10291
sequence = TTTGAAATTTTCTCTTCATT

Site:
position = -136
score = 5.05214
sequence = GACGAAAAGAATTCTTCACA

Gene: Atu2145: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
*
Mesorhizobium sp. BNC1

Site:
position = -123
score = 4.53296
sequence = TTTGAAATTAATCATTCAGA

Site:
position = -81
score = 5.41718
sequence = TTTGAAAAATTCTCTTCACC

Gene: Meso_1872: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -32
score = 5.85013
sequence = TCTGAAAATTTCTTTTCATG

Site:
position = -74
score = 5.31833
sequence = TAAGAAAAGAATTCTTCAGG

Gene: RHE_CH02889: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -144
score = 5.04026
sequence = GAAGAAAAGAATTCTTCAGG

Site:
position = -102
score = 5.692
sequence = ACTGAAAATTTCTTTTCATG

Gene: RL3349: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Rhizobium sp. NGR234

Site:
position = -136
score = 5.66532
sequence = CGTGAAAAGAATTCTTCACG

Site:
position = -94
score = 5.7199
sequence = TCTGAAACGATCTTTTCAGT

Gene: NGR_c21480: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -137
score = 5.58848
sequence = TGTGAAGAGAATTCTTCACG

Site:
position = -95
score = 5.57718
sequence = ACTGAAACGATCTTTTCAAA

Gene: SMc01602: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Xanthobacter autotrophicus Py2
Transcriptional regulator of ethanolamine utilization, RpiR family
 
CRON 2.
eutA
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -56
score = 5.05214
sequence = TGTGAAGAATTCTTTTCGTC

Site:
position = -98
score = 5.10291
sequence = AATGAAGAGAAAATTTCAAA

Gene: Atu2144: putative N-formylglutamate amidohydrolase family protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
*
Mesorhizobium sp. BNC1

Site:
position = -89
score = 5.41718
sequence = GGTGAAGAGAATTTTTCAAA

Site:
position = -47
score = 4.53296
sequence = TCTGAATGATTAATTTCAAA

Gene: Meso_1871: putative N-formylglutamate amidohydrolase family protein
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -169
score = 5.85013
sequence = CATGAAAAGAAATTTTCAGA

Site:
position = -127
score = 5.31833
sequence = CCTGAAGAATTCTTTTCTTA

Gene: RHE_CH02888: putative N-formylglutamate amidohydrolase family protein
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -57
score = 5.04026
sequence = CCTGAAGAATTCTTTTCTTC

Site:
position = -99
score = 5.692
sequence = CATGAAAAGAAATTTTCAGT

Gene: RL3348: putative N-formylglutamate amidohydrolase family protein
*
Rhizobium sp. NGR234

Site:
position = -93
score = 5.7199
sequence = ACTGAAAAGATCGTTTCAGA

Site:
position = -51
score = 5.66532
sequence = CGTGAAGAATTCTTTTCACG

Gene: NGR_c21470: putative N-formylglutamate amidohydrolase family protein
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -95
score = 5.57718
sequence = TTTGAAAAGATCGTTTCAGT

Site:
position = -53
score = 5.58848
sequence = CGTGAAGAATTCTCTTCACA

Gene: SMc01600: putative N-formylglutamate amidohydrolase family protein
 
Xanthobacter autotrophicus Py2
putative N-formylglutamate amidohydrolase family protein
eutT
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2143: Ethanolamine permease, APC family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2262: Ethanolamine permease, APC family
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH02887: Ethanolamine permease, APC family
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3347: Ethanolamine permease, APC family

Gene: RL4367: Ethanolamine permease, APC family
 
Rhizobium sp. NGR234

Gene: NGR_c21460: Ethanolamine permease, APC family
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc01597: Ethanolamine permease, APC family
 
Xanthobacter autotrophicus Py2
Ethanolamine permease, APC family
eutB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2142: glutamine synthetase family protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1

Gene: Meso_1870: glutamine synthetase family protein
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH02886: glutamine synthetase family protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3346: glutamine synthetase family protein
 
Rhizobium sp. NGR234

Gene: NGR_c21450: glutamine synthetase family protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc01594: glutamine synthetase family protein
 
Xanthobacter autotrophicus Py2
glutamine synthetase family protein
Atu2141
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2141: hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
hypothetical protein
Atu2140
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2140: hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
hypothetical protein
eutX
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2139: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1

Gene: Meso_1869: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH02885: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3345: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Rhizobium sp. NGR234

Gene: NGR_c21440: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc01588: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Xanthobacter autotrophicus Py2
Aldehyde dehydrogenase (EC 1.2.1.3)
eutY
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2138: Alcohol dehydrogenase (EC 1.1.1.1)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1

Gene: Meso_1868: Alcohol dehydrogenase (EC 1.1.1.1)
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH02884: Alcohol dehydrogenase (EC 1.1.1.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3344: Alcohol dehydrogenase (EC 1.1.1.1)
 
Rhizobium sp. NGR234

Gene: NGR_c21430: Alcohol dehydrogenase (EC 1.1.1.1)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc01582: Alcohol dehydrogenase (EC 1.1.1.1)
 
Xanthobacter autotrophicus Py2
Alcohol dehydrogenase (EC 1.1.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD