Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EutR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 30 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53 8 2
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597 9 2
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222 8 2
Rhodobacter sphaeroides 2.4.1 8 2
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193 8 2
Roseovarius nubinhibens ISM 8 2
Roseovarius sp. 217 8 2
Silicibacter TM1040 8 2
Silicibacter pomeroyi DSS-3 8 2
Sulfitobacter sp. EE-36 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
eutA
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
*
Loktanella vestfoldensis SKA53

Site:
position = -101
score = 4.96778
sequence = GTTGAAACGTTTGTTTCAAA

Gene: SKA53_10329: COG3931: Predicted N-formylglutamate amidohydrolase
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -53
score = 5.26582
sequence = TTTGTAGAAATTGTTACAGG

Gene: OB2597_09009: COG3931: Predicted N-formylglutamate amidohydrolase
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -93
score = 4.08191
sequence = TTCGTAACATTCTTAACAGG

Site:
position = -63
score = 5.0671
sequence = TCTGAAAAATAATTGACAGA

Gene: Pden_4543: COG3931: Predicted N-formylglutamate amidohydrolase
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -87
score = 4.32351
sequence = GAAGAAAAATTCTTGACAGA

Site:
position = -116
score = 4.62553
sequence = GCAGTAAACATCTTAACAGC

Gene: RSP_2323: COG3931: Predicted N-formylglutamate amidohydrolase
 
Rhodobacterales bacterium HTCC2654
*
Roseobacter sp. MED193

Site:
position = -64
score = 5.06191
sequence = TCTGAAATTATATTGACAGA

Site:
position = -34
score = 5.11337
sequence = CGTGAAAAGATTTTTCCAAA

Gene: MED193_10026: COG3931: Predicted N-formylglutamate amidohydrolase
*
Roseovarius nubinhibens ISM

Site:
position = -62
score = 5.75781
sequence = TGTGAAAACATTTTTTCAAA

Gene: ISM_11445: COG3931: Predicted N-formylglutamate amidohydrolase
*
Roseovarius sp. 217

Site:
position = -36
score = 5.6105
sequence = TGTGGAAACATTTTTACAAA

Site:
position = -66
score = 4.82484
sequence = GCTGGAAATATATTGACACA

Gene: ROS217_08284: COG3931: Predicted N-formylglutamate amidohydrolase
*
Silicibacter TM1040

Site:
position = -54
score = 5.19503
sequence = GATGAAAGAATTTTTACAGA

Gene: TM1040_2787: COG3931: Predicted N-formylglutamate amidohydrolase
*
Silicibacter pomeroyi DSS-3

Site:
position = -10
score = 5.1223
sequence = GTTGTAACCAATGTTACACA

Site:
position = -54
score = 5.33844
sequence = TCTGTAATCATGTCTACAGA

Gene: SPO2603: COG3931: Predicted N-formylglutamate amidohydrolase
*
Sulfitobacter sp. EE-36

Site:
position = -83
score = 4.7874
sequence = TGTGAAGCAAAGATTACAGA

Gene: EE36_04403: COG3931: Predicted N-formylglutamate amidohydrolase
COG3931: Predicted N-formylglutamate amidohydrolase
eutQ
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10324: TRAP-type ethanolamine transport system, small permease component
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_09004: TRAP-type ethanolamine transport system, small permease component
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4544: TRAP-type ethanolamine transport system, small permease component
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2322: TRAP-type ethanolamine transport system, small permease component
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_10031: TRAP-type ethanolamine transport system, small permease component
 
Roseovarius nubinhibens ISM

Gene: ISM_11440: TRAP-type ethanolamine transport system, small permease component
 
Roseovarius sp. 217

Gene: ROS217_08289: TRAP-type ethanolamine transport system, small permease component
 
Silicibacter TM1040

Gene: TM1040_2786: TRAP-type ethanolamine transport system, small permease component
 
Silicibacter pomeroyi DSS-3

Gene: SPO2604: TRAP-type ethanolamine transport system, small permease component
 
Sulfitobacter sp. EE-36

Gene: EE36_04398: TRAP-type ethanolamine transport system, small permease component
TRAP-type ethanolamine transport system, small permease component
eutM
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10319: TRAP-type ethanolamine transport system, large permease component
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08999: TRAP-type ethanolamine transport system, large permease component
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4545: TRAP-type ethanolamine transport system, large permease component
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2321: TRAP-type ethanolamine transport system, large permease component
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_10036: TRAP-type ethanolamine transport system, large permease component
 
Roseovarius nubinhibens ISM

Gene: ISM_11435: TRAP-type ethanolamine transport system, large permease component
 
Roseovarius sp. 217

Gene: ROS217_08294: TRAP-type ethanolamine transport system, large permease component
 
Silicibacter TM1040

Gene: TM1040_2785: TRAP-type ethanolamine transport system, large permease component
 
Silicibacter pomeroyi DSS-3

Gene: SPO2605: TRAP-type ethanolamine transport system, large permease component
 
Sulfitobacter sp. EE-36

Gene: EE36_04393: TRAP-type ethanolamine transport system, large permease component
TRAP-type ethanolamine transport system, large permease component
eutP
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10314: TRAP-type ethanolamine transport system, periplasmic component
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08994: TRAP-type ethanolamine transport system, periplasmic component
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4546: TRAP-type ethanolamine transport system, periplasmic component
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2320: TRAP-type ethanolamine transport system, periplasmic component
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_10041: TRAP-type ethanolamine transport system, periplasmic component
 
Roseovarius nubinhibens ISM

Gene: ISM_11430: TRAP-type ethanolamine transport system, periplasmic component
 
Roseovarius sp. 217

Gene: ROS217_08299: TRAP-type ethanolamine transport system, periplasmic component
 
Silicibacter TM1040

Gene: TM1040_2784: TRAP-type ethanolamine transport system, periplasmic component
 
Silicibacter pomeroyi DSS-3

Gene: SPO2606: TRAP-type ethanolamine transport system, periplasmic component
 
Sulfitobacter sp. EE-36

Gene: EE36_04388: TRAP-type ethanolamine transport system, periplasmic component
TRAP-type ethanolamine transport system, periplasmic component
eutB
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10309: glutamine synthetase family protein
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08989: glutamine synthetase family protein
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4547: glutamine synthetase family protein
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2319: glutamine synthetase family protein
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_10046: glutamine synthetase family protein
 
Roseovarius nubinhibens ISM

Gene: ISM_11425: glutamine synthetase family protein
 
Roseovarius sp. 217

Gene: ROS217_08304: glutamine synthetase family protein
 
Silicibacter TM1040

Gene: TM1040_2783: glutamine synthetase family protein
 
Silicibacter pomeroyi DSS-3

Gene: SPO2607: glutamine synthetase family protein
 
Sulfitobacter sp. EE-36

Gene: EE36_04383: glutamine synthetase family protein
glutamine synthetase family protein
OB2597_08984
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08984: BIPHENYL-2,3-DIOL 1,2-DIOXYGENASE III (EC 1.13.11.39)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
 
Rhodobacter sphaeroides 2.4.1
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
BIPHENYL-2,3-DIOL 1,2-DIOXYGENASE III (EC 1.13.11.39)
eutX
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10304: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08979: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4548: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2318: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_10051: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Roseovarius nubinhibens ISM

Gene: ISM_11420: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Roseovarius sp. 217

Gene: ROS217_08309: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Silicibacter TM1040

Gene: TM1040_2782: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Silicibacter pomeroyi DSS-3

Gene: SPO2608: Aldehyde dehydrogenase (EC 1.2.1.3)
 
Sulfitobacter sp. EE-36

Gene: EE36_04378: Aldehyde dehydrogenase (EC 1.2.1.3)
Aldehyde dehydrogenase (EC 1.2.1.3)
eutY
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_10299: Alcohol dehydrogenase (EC 1.1.1.1)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_08974: Alcohol dehydrogenase (EC 1.1.1.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4549: Alcohol dehydrogenase (EC 1.1.1.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2317: Alcohol dehydrogenase (EC 1.1.1.1)
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193

Gene: MED193_10056: Alcohol dehydrogenase (EC 1.1.1.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_11415: Alcohol dehydrogenase (EC 1.1.1.1)
 
Roseovarius sp. 217

Gene: ROS217_08314: Alcohol dehydrogenase (EC 1.1.1.1)
 
Silicibacter TM1040

Gene: TM1040_2781: Alcohol dehydrogenase (EC 1.1.1.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO2609: Alcohol dehydrogenase (EC 1.1.1.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_04373: Alcohol dehydrogenase (EC 1.1.1.1)
Alcohol dehydrogenase (EC 1.1.1.1)
 
CRON 2.
eutR
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
*
Loktanella vestfoldensis SKA53

Site:
position = -46
score = 4.96778
sequence = TTTGAAACAAACGTTTCAAC

Gene: SKA53_10334: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Oceanicaulis alexandrii HTCC2633
*
Oceanicola batsensis HTCC2597

Site:
position = -53
score = 5.26582
sequence = CCTGTAACAATTTCTACAAA

Gene: OB2597_09014: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -48
score = 4.08191
sequence = CCTGTTAAGAATGTTACGAA

Site:
position = -78
score = 5.0671
sequence = TCTGTCAATTATTTTTCAGA

Gene: Pden_4542: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -107
score = 4.32351
sequence = TCTGTCAAGAATTTTTCTTC

Site:
position = -78
score = 4.62553
sequence = GCTGTTAAGATGTTTACTGC

Gene: RSP_2324: Transcriptional regulator of ethanolamine utilization, RpiR family
 
Rhodobacterales bacterium HTCC2654
*
Roseobacter sp. MED193

Site:
position = -143
score = 5.11337
sequence = TTTGGAAAAATCTTTTCACG

Site:
position = -113
score = 5.06191
sequence = TCTGTCAATATAATTTCAGA

Gene: MED193_10021: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Roseovarius nubinhibens ISM

Site:
position = -109
score = 5.75781
sequence = TTTGAAAAAATGTTTTCACA

Gene: ISM_11450: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Roseovarius sp. 217

Site:
position = 11
score = 4.82484
sequence = TGTGTCAATATATTTCCAGC

Site:
position = -19
score = 5.6105
sequence = TTTGTAAAAATGTTTCCACA

Gene: ROS217_08279: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Silicibacter TM1040

Site:
position = -70
score = 5.19503
sequence = TCTGTAAAAATTCTTTCATC

Gene: TM1040_2788: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Silicibacter pomeroyi DSS-3

Site:
position = -105
score = 5.1223
sequence = TGTGTAACATTGGTTACAAC

Site:
position = -61
score = 5.33844
sequence = TCTGTAGACATGATTACAGA

Gene: SPO2602: Transcriptional regulator of ethanolamine utilization, RpiR family
*
Sulfitobacter sp. EE-36

Site:
position = -51
score = 4.7874
sequence = TCTGTAATCTTTGCTTCACA

Gene: EE36_04408: Transcriptional regulator of ethanolamine utilization, RpiR family
Transcriptional regulator of ethanolamine utilization, RpiR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD