Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP 2 2
Pseudomonas aeruginosa PAO1 2 1
Pseudomonas entomophila L48 3 2
Pseudomonas fluorescens Pf-5 2 2
Pseudomonas mendocina ymp 2 1
Pseudomonas putida KT2440 3 2
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grtT
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
*
Pseudomonas entomophila L48

Site:
position = -107
score = 5.77049
sequence = GGCTGTGCGAAAGCACAAAG

Gene: PSEEN2880: Predicted D-glycerate transporter, MFS family
*
Pseudomonas fluorescens Pf-5

Site:
position = -2
score = 5.29196
sequence = CGTTGTTCAGTGGCACAGGG

Site:
position = 30
score = 5.58691
sequence = CGCTGTGCGCCGGCACAAAG

Gene: PFL_3380: Predicted D-glycerate transporter, MFS family
 
Pseudomonas mendocina ymp
*
Pseudomonas putida KT2440

Site:
position = -107
score = 5.97178
sequence = CGCTGTGCAAAAGCACAAAG

Gene: PP3176: Predicted D-glycerate transporter, MFS family
 
Pseudomonas stutzeri A1501
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -133
score = 5.25065
sequence = CGTTGTGCAATCACACAACA

Gene: PSPTO1906: Predicted D-glycerate transporter, MFS family
Predicted D-glycerate transporter, MFS family
 
CRON 2.
sdaR
*
Azotobacter vinelandii AvOP

Site:
position = -154
score = 5.23439
sequence = GCTTGTGCAGATGAACAATG

Gene: Avin_43380: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Pseudomonas aeruginosa PAO1

Gene: PA1050: Glycerate utilization transcriptional regulator SdaR, SdaR family
*
Pseudomonas entomophila L48

Site:
position = -75
score = 5.77049
sequence = CTTTGTGCTTTCGCACAGCC

Gene: PSEEN2879: Glycerate utilization transcriptional regulator SdaR, SdaR family
*
Pseudomonas fluorescens Pf-5

Site:
position = -106
score = 5.58691
sequence = CTTTGTGCCGGCGCACAGCG

Site:
position = -74
score = 5.29196
sequence = CCCTGTGCCACTGAACAACG

Gene: PFL_3379: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Pseudomonas mendocina ymp

Gene: Pmen_1437: Glycerate utilization transcriptional regulator SdaR, SdaR family
*
Pseudomonas putida KT2440

Site:
position = -4
score = 5.97178
sequence = CTTTGTGCTTTTGCACAGCG

Gene: PP3177: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3281: Glycerate utilization transcriptional regulator SdaR, SdaR family
Glycerate utilization transcriptional regulator SdaR, SdaR family
garK
*
Azotobacter vinelandii AvOP

Site:
position = -132
score = 5.64791
sequence = TTTTGTGCGTTTGCACAGAA

Gene: Avin_43390: Glycerate kinase (EC 2.7.1.31)
 
Pseudomonas aeruginosa PAO1

Gene: PA1052: Glycerate kinase (EC 2.7.1.31)
 
Pseudomonas entomophila L48

Gene: PSEEN2878: Glycerate kinase (EC 2.7.1.31)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3378: Glycerate kinase (EC 2.7.1.31)
 
Pseudomonas mendocina ymp

Gene: Pmen_1439: Glycerate kinase (EC 2.7.1.31)
 
Pseudomonas putida KT2440

Gene: PP3178: Glycerate kinase (EC 2.7.1.31)
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO3280: Glycerate kinase (EC 2.7.1.31)
Glycerate kinase (EC 2.7.1.31)
grtP
 
Azotobacter vinelandii AvOP
*
Pseudomonas aeruginosa PAO1

Site:
position = -141
score = 5.58178
sequence = CACTGTGCAGTCGCACAAAA

Gene: PA1051: D-glycerate transporter, GntP family
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -156
score = 5.71997
sequence = GGTTGTGCATGTGCACAGCC

Gene: Pmen_1438: D-glycerate transporter, GntP family
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
D-glycerate transporter, GntP family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD