Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306 3 1
Xanthomonas campestris pv. campestris str. ATCC 33913 3 1
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grtP
 
Stenotrophomonas maltophilia K279a
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -102
score = 6.08382
sequence = ATTTGGGCAGTTGCACAAAA

Gene: XAC4361: D-glycerate transporter, GntP family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -88
score = 5.12387
sequence = GCTTGGGTGTTTGCACAAAA

Gene: XCC4227: D-glycerate transporter, GntP family
 
Xylella fastidiosa 9a5c
D-glycerate transporter, GntP family
garK
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC4360: Glycerate kinase (EC 2.7.1.31)
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC4226: Glycerate kinase (EC 2.7.1.31)
 
Xylella fastidiosa 9a5c
Glycerate kinase (EC 2.7.1.31)
sdaR
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC4359: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC4225: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Xylella fastidiosa 9a5c
Glycerate utilization transcriptional regulator SdaR, SdaR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD