Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 38 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 13 5
Arthrobacter chlorophenolicus A6 14 7
Arthrobacter sp. FB24 15 7
Beutenbergia cavernae DSM 12333
Brachybacterium faecium DSM 4810
Brevibacterium linens BL2 14 4
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201 11 5
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209 12 3
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaA
*
Arthrobacter aurescens TC1

Site:
position = -36
score = 5.5853
sequence = TCTGAACGAACGGTCGGTAATT

Gene: AAur_3226: Phenylacetate-CoA oxygenase, PaaA subunit
*
Arthrobacter chlorophenolicus A6

Site:
position = -64
score = 5.48047
sequence = CCTGAACGAACGGTCGGTAAAT

Gene: Achl_2964: Phenylacetate-CoA oxygenase, PaaA subunit
*
Arthrobacter sp. FB24

Site:
position = -49
score = 5.56542
sequence = CCTGAACGAACGGTCGGTAATT

Gene: Arth_3218: Phenylacetate-CoA oxygenase, PaaA subunit
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -101
score = 4.20209
sequence = ACAGAACAAATGGTCAGTAAAT

Gene: BlinB01000722: Phenylacetate-CoA oxygenase, PaaA subunit
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -210
score = 5.01457
sequence = ATTTTCAGAACGATCGGTCAGT

Site:
position = -67
score = 4.80947
sequence = TCTGAACGAGCGGTCAGTTATT

Gene: KRH_02150: Phenylacetate-CoA oxygenase, PaaA subunit
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_09290: Phenylacetate-CoA oxygenase, PaaA subunit
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -66
score = 4.9379
sequence = ATATACTGAACGAACGGTCAGT

Site:
position = -62
score = 5.38967
sequence = ACTGAACGAACGGTCAGTAATT

Gene: RSal33209_2662: Phenylacetate-CoA oxygenase, PaaA subunit
 
Tropheryma whipplei str. Twist
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Arthrobacter aurescens TC1

Gene: AAur_3225: Phenylacetate-CoA oxygenase, PaaB subunit
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2963: Phenylacetate-CoA oxygenase, PaaB subunit
 
Arthrobacter sp. FB24

Gene: Arth_3217: Phenylacetate-CoA oxygenase, PaaB subunit
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000723: Phenylacetate-CoA oxygenase, PaaB subunit
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02140: Phenylacetate-CoA oxygenase, PaaB subunit
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_09300: Phenylacetate-CoA oxygenase, PaaB subunit
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2661: Phenylacetate-CoA oxygenase, PaaB subunit
 
Tropheryma whipplei str. Twist
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Arthrobacter aurescens TC1

Gene: AAur_3224: Phenylacetate-CoA oxygenase, PaaC subunit
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2962: Phenylacetate-CoA oxygenase, PaaC subunit
 
Arthrobacter sp. FB24

Gene: Arth_3216: Phenylacetate-CoA oxygenase, PaaC subunit
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000724: Phenylacetate-CoA oxygenase, PaaC subunit
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02130: Phenylacetate-CoA oxygenase, PaaC subunit
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_09310: Phenylacetate-CoA oxygenase, PaaC subunit
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2660: Phenylacetate-CoA oxygenase, PaaC subunit
 
Tropheryma whipplei str. Twist
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Arthrobacter aurescens TC1

Gene: AAur_3223: Phenylacetate-CoA oxygenase, PaaD subunit
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2961: Phenylacetate-CoA oxygenase, PaaD subunit
 
Arthrobacter sp. FB24

Gene: Arth_3215: Phenylacetate-CoA oxygenase, PaaD subunit
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000725: Phenylacetate-CoA oxygenase, PaaD subunit
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02120: Phenylacetate-CoA oxygenase, PaaD subunit
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_09320: Phenylacetate-CoA oxygenase, PaaD subunit
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2659: Phenylacetate-CoA oxygenase, PaaD subunit
 
Tropheryma whipplei str. Twist
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Arthrobacter aurescens TC1

Gene: AAur_3222: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2960: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Arthrobacter sp. FB24

Gene: Arth_3214: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000726: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02110: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_09330: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2658: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
 
Tropheryma whipplei str. Twist
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaJ
*
Arthrobacter aurescens TC1

Site:
position = -63
score = 4.68486
sequence = ATAGAACGAACGGTCGGTATAT

Gene: AAur_3260: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Arthrobacter chlorophenolicus A6

Site:
position = -83
score = 5.55788
sequence = ACAGAACGAACGGTCGGTAAGT

Site:
position = -87
score = 5.23596
sequence = ATTTACAGAACGAACGGTCGGT

Gene: Achl_3063: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
*
Arthrobacter sp. FB24

Site:
position = -83
score = 5.09372
sequence = ATAGAACGAACGGTCGGTAAAT

Gene: Arth_3268: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000727: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02300: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -46
score = 4.74155
sequence = ATTGAACGATTGGTCAGTAAAT

Gene: RSal33209_2690: Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
 
Tropheryma whipplei str. Twist
Beta-ketoadipyl CoA thiolase (EC 2.3.1.-)
paaF
 
Arthrobacter aurescens TC1

Gene: AAur_3259: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3062: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter sp. FB24

Gene: Arth_3267: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000728: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02290: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2689: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Tropheryma whipplei str. Twist
Enoyl-CoA hydratase (EC 4.2.1.17)
paaH
 
Arthrobacter aurescens TC1

Gene: AAur_3258: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3061: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Arthrobacter sp. FB24

Gene: Arth_3266: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000729: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02280: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2688: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Tropheryma whipplei str. Twist
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaG
 
Arthrobacter aurescens TC1

Gene: AAur_3221: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2959: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Arthrobacter sp. FB24

Gene: Arth_3213: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000730: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02100: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_19430: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2657: Enoyl-CoA hydratase (EC 4.2.1.17)
 
Tropheryma whipplei str. Twist
Enoyl-CoA hydratase (EC 4.2.1.17)
 
CRON 2.
paaT
*
Arthrobacter aurescens TC1

Site:
position = -70
score = 5.13094
sequence = CCTAACTGACCGTTCTGTCGGT

Gene: AAur_2544: Predicted phylacetic acid transporter PaaT
*
Arthrobacter chlorophenolicus A6

Site:
position = -73
score = 5.33
sequence = ACCAACTGACCGTTCTGTCGGT

Gene: Achl_2302: Predicted phylacetic acid transporter PaaT
*
Arthrobacter sp. FB24

Site:
position = -87
score = 5.70611
sequence = ACTGACCGTTCGATCGGTAATT

Gene: Arth_2568: Predicted phylacetic acid transporter PaaT
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -191
score = 5.47491
sequence = ACTAACCAATCGGTCGGTTATT

Gene: BlinB01000710: Predicted phylacetic acid transporter PaaT
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -81
score = 4.59608
sequence = CAAGACCAATCGGTCGGTAAAT

Gene: KRH_02310: Predicted phylacetic acid transporter PaaT
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1501: Predicted phylacetic acid transporter PaaT
 
Tropheryma whipplei str. Twist
Predicted phylacetic acid transporter PaaT
 
CRON 3.
paaI
*
Arthrobacter aurescens TC1

Site:
position = -42
score = 5.12582
sequence = ACCTAATGAACATTCGGTAAAT

Gene: AAur_3243: Phenylacetic acid degradation protein PaaI, thioesterase
*
Arthrobacter chlorophenolicus A6

Site:
position = -42
score = 5.12582
sequence = ACCTAATGAACATTCGGTAAAT

Gene: Achl_3047: Phenylacetic acid degradation protein PaaI, thioesterase
*
Arthrobacter sp. FB24

Site:
position = -42
score = 5.12582
sequence = ACCTAATGAACATTCGGTAAAT

Gene: Arth_3246: Phenylacetic acid degradation protein PaaI, thioesterase
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -138
score = 4.43893
sequence = ATTGACCAGATGGTCGTTTATT

Gene: BlinB01000721: Phenylacetic acid degradation protein PaaI, thioesterase
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -38
score = 5.01457
sequence = ACTGACCGATCGTTCTGAAAAT

Site:
position = -181
score = 4.80947
sequence = AATAACTGACCGCTCGTTCAGA

Gene: KRH_02160: Phenylacetic acid degradation protein PaaI, thioesterase
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2672: Phenylacetic acid degradation protein PaaI, thioesterase
 
Tropheryma whipplei str. Twist
Phenylacetic acid degradation protein PaaI, thioesterase
paaK
 
Arthrobacter aurescens TC1

Gene: AAur_3244: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_3048: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Arthrobacter sp. FB24

Gene: Arth_3247: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000720: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02170: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2673: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Tropheryma whipplei str. Twist
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR
 
Arthrobacter aurescens TC1
*
Arthrobacter chlorophenolicus A6

Site:
position = -32
score = 4.57995
sequence = GCTGACCGACCGTTCGTGAGAA

Gene: Achl_3049: transcriptional regulator, TetR family
*
Arthrobacter sp. FB24

Site:
position = -32
score = 4.35886
sequence = ATTGACCGAACGTTCATGAGAA

Gene: Arth_3248: transcriptional regulator, TetR family
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01000719: transcriptional regulator, TetR family
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_02180: transcriptional regulator, TetR family
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2674: transcriptional regulator, TetR family
 
Tropheryma whipplei str. Twist
transcriptional regulator, TetR family
 
CRON 4.
paaY
 
Arthrobacter aurescens TC1
*
Arthrobacter chlorophenolicus A6

Site:
position = -70
score = 4.55059
sequence = GATTACTGACCGTCCGTTCGGT

Site:
position = -66
score = 5.62733
sequence = ACTGACCGTCCGTTCGGTAATA

Gene: Achl_3054: putative thioesterase family domain protein
*
Arthrobacter sp. FB24

Site:
position = -132
score = 4.5818
sequence = CATTACTGACCGTCCGTTCGGT

Site:
position = -128
score = 5.62733
sequence = ACTGACCGTCCGTTCGGTAATA

Gene: Arth_3256: putative thioesterase family domain protein
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -268
score = 5.25846
sequence = GTTAGCCGAACGATCGGTCAGT

Site:
position = -264
score = 4.23055
sequence = GCCGAACGATCGGTCAGTATTG

Gene: KRH_02210: putative thioesterase family domain protein
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
putative thioesterase family domain protein
 
CRON 5.
RSal33209_2682
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -91
score = 4.8245
sequence = AATTACTGACCACTCGTTCAGT

Gene: RSal33209_2682: 2-hydroxyphenylacetyl-CoA ring opening enzyme
 
Tropheryma whipplei str. Twist
2-hydroxyphenylacetyl-CoA ring opening enzyme
paaZ
*
Arthrobacter aurescens TC1

Site:
position = -61
score = 5.4321
sequence = TATTACCGAACGGCCGGTCAGT

Gene: AAur_3246: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Arthrobacter chlorophenolicus A6

Site:
position = -82
score = 5.62733
sequence = TATTACCGAACGGACGGTCAGT

Gene: Achl_3053: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Arthrobacter sp. FB24

Site:
position = -72
score = 5.62733
sequence = TATTACCGAACGGACGGTCAGT

Gene: Arth_3255: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -101
score = 5.47491
sequence = AATAACCGACCGATTGGTTAGT

Gene: BlinB01000711: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -48
score = 5.25846
sequence = ACTGACCGATCGTTCGGCTAAC

Gene: KRH_02200: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 2
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_2680: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Gene: RSal33209_2681: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
Tropheryma whipplei str. Twist
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD