Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FnrN - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 18 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acetobacter pasteurianus IFO 3283-01 3 2
Azospirillum sp. B510 5 2
Gluconacetobacter diazotrophicus PAl 5 3 2
Gluconobacter oxydans 621H 2 2
Granulibacter bethesdensis CGDNIH1
Magnetospirillum magneticum AMB-1 1 1
Magnetospirillum magnetotacticum MS-1 4 2
Rhodospirillum centenum SW 7 4
Rhodospirillum rubrum ATCC 11170 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ompW
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -90
score = 6.00186
sequence = GATTTGATCTAAATCAAGGC

Gene: APA01_25640: Outer membrane protein W precursor
 
Azospirillum sp. B510

Gene: AZL_c00520: Outer membrane protein W precursor
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -94
score = 4.83373
sequence = CGGTTGATTCATGTCAAGGC

Gene: Gdia_1985: Outer membrane protein W precursor
*
Gluconobacter oxydans 621H

Site:
position = -75
score = 5.41318
sequence = GACTTGATTCAGGTCAACGT

Gene: GOX0973: Outer membrane protein W precursor
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
*
Rhodospirillum centenum SW

Site:
position = -121
score = 5.50714
sequence = GAATTGATCCAGGTCAGGGC

Gene: RC1_1607: Outer membrane protein W precursor
 
Rhodospirillum rubrum ATCC 11170
Outer membrane protein W precursor
hemN
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_25630: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1986: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
CRON 2.
ccoN
 
Acetobacter pasteurianus IFO 3283-01
*
Azospirillum sp. B510

Site:
position = -192
score = 5.08125
sequence = TCGTTGACGTAGATCAATGT

Gene: AZL_003350: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -161
score = 4.97722
sequence = ACTTTGATATATGTCAATGG

Gene: Magn03010411: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Rhodospirillum centenum SW

Site:
position = -190
score = 4.90273
sequence = GCATTGACATTCGTCAAAAC

Site:
position = -120
score = 5.43259
sequence = CCGTTGATTCAAATCAATGC

Gene: RC1_1280: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -324
score = 5.69943
sequence = GATTTGATCTAAATCAATGG

Gene: Rru_A3332: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510

Gene: AZL_003360: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb4363: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010410: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Rhodospirillum centenum SW

Gene: RC1_1279: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A3331: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510

Gene: AZL_003370: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb4364: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW

Gene: RC1_1278: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Rhodospirillum rubrum ATCC 11170
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510

Gene: AZL_003380: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb4365: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010409: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Rhodospirillum centenum SW

Gene: RC1_1277: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A3330: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
CRON 3.
cycA
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
*
Magnetospirillum magneticum AMB-1

Site:
position = -78
score = 5.88746
sequence = GACTTGACCTTGCTCAATGC

Gene: amb0883: Cytochrome c4 precursor
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -77
score = 5.88746
sequence = GACTTGACCTTGCTCAATGC

Gene: Magn03010752: Cytochrome c4 precursor
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Cytochrome c4 precursor
 
CRON 4.
hemA
 
Acetobacter pasteurianus IFO 3283-01
*
Azospirillum sp. B510

Site:
position = -138
score = 5.50372
sequence = GGCTTGATTTCGATCAATGC

Gene: AZL_003210: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb1683: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010319: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhodospirillum centenum SW

Site:
position = -164
score = 5.44628
sequence = GAATTGACCGACATCAACGC

Gene: RC1_0996: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A2508: 5-aminolevulinate synthase (EC 2.3.1.37)
5-aminolevulinate synthase (EC 2.3.1.37)
 
CRON 5.
fnrN
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -207
score = 6.00186
sequence = GCCTTGATTTAGATCAAATC

Gene: APA01_25650: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Azospirillum sp. B510

Gene: AZL_003420: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -126
score = 5.98814
sequence = GCATTGATTCAGATCAATTC

Gene: Gdia_1984: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Gluconobacter oxydans 621H

Site:
position = -90
score = 5.41318
sequence = ACGTTGACCTGAATCAAGTC

Gene: GOX0974: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb4369: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010404: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Rhodospirillum centenum SW

Site:
position = -305
score = 5.17043
sequence = ACCTTGACTTGGATCAAGAC

Gene: RC1_2984: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -119
score = 4.62425
sequence = GGTTTGACCTGGATCAAAAT

Gene: Rru_A3322: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD