Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FixK - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 14 6
Caulobacter segnis ATCC 21756 23 7
Caulobacter sp. K31 23 5
Phenylobacterium zucineum HLK1 10 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ccoN
*
Caulobacter crescentus CB15

Site:
position = -73
score = 5.76391
sequence = GCTTTGATGCGTGTCAAAGC

Gene: CC1401: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Caulobacter segnis ATCC 21756

Site:
position = -75
score = 5.71291
sequence = GCTTTGAGACAGATCAAAGC

Gene: Cseg_1883: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Caulobacter sp. K31

Site:
position = -69
score = 4.53934
sequence = GCTTTGACCCAAGTCAATTT

Gene: Caul_2437: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Phenylobacterium zucineum HLK1

Site:
position = -40
score = 5.9562
sequence = GCCTTGACCGATATCAAGGC

Gene: PHZ_c2814: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
 
Caulobacter crescentus CB15

Gene: CC1402: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1884: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Caulobacter sp. K31

Gene: Caul_2438: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2813: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
 
Caulobacter crescentus CB15

Gene: CC1403: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1885: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Caulobacter sp. K31

Gene: Caul_2439: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2812: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
 
Caulobacter crescentus CB15

Gene: CC1404: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1886: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Caulobacter sp. K31

Gene: Caul_2440: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2811: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
 
Caulobacter crescentus CB15

Gene: CC1405: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1887: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Caulobacter sp. K31

Gene: Caul_2441: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2810: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
 
Caulobacter crescentus CB15

Gene: CC1406: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1888: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Caulobacter sp. K31

Gene: Caul_2442: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2809: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
 
Caulobacter crescentus CB15

Gene: CC1407: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1889: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Caulobacter sp. K31

Gene: Caul_2443: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2808: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
 
Caulobacter crescentus CB15

Gene: CC1408: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1890: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Caulobacter sp. K31

Gene: Caul_2444: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2807: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
CRON 2.
hemN
 
Caulobacter crescentus CB15

Gene: CC1411: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Caulobacter segnis ATCC 21756

Site:
position = -65
score = 4.70535
sequence = GGATTGATCCAAATCACGGC

Gene: Cseg_1891: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Caulobacter sp. K31

Site:
position = -64
score = 5.20395
sequence = GACTTGACGCGCGTCAAGGT

Gene: Caul_3872: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Phenylobacterium zucineum HLK1

Site:
position = -52
score = 5.26772
sequence = TCCTTGATCTGAATCAGGGC

Gene: PHZ_c2806: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
CRON 3.
cydA
*
Caulobacter crescentus CB15

Site:
position = -93
score = 6.17819
sequence = GCCTTGATCCGGATCAAGGA

Gene: CC0762: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
*
Caulobacter segnis ATCC 21756

Site:
position = -92
score = 5.75795
sequence = TCCTTGATCACGATCAAGGC

Gene: Cseg_3605: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
*
Caulobacter sp. K31

Site:
position = -92
score = 5.4648
sequence = TCCTTGACACCAATCAAAGC

Gene: Caul_0634: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Phenylobacterium zucineum HLK1
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
 
Caulobacter crescentus CB15

Gene: CC0763: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3604: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Caulobacter sp. K31

Gene: Caul_0635: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Phenylobacterium zucineum HLK1
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydX
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3603: CydX protein, presumably involved in maturation of CydAB complex
 
Caulobacter sp. K31

Gene: Caul_0636: CydX protein, presumably involved in maturation of CydAB complex
 
Phenylobacterium zucineum HLK1
CydX protein, presumably involved in maturation of CydAB complex
 
CRON 4.
ctaC
*
Caulobacter crescentus CB15

Site:
position = -45
score = 5.62979
sequence = GCCTTGATCGGGCTCAAATC

Site:
position = -12
score = 4.89948
sequence = GCCGTGAGGGATATGAAGGC

Gene: CC3407: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Caulobacter segnis ATCC 21756

Site:
position = -45
score = 4.1852
sequence = ACATTGATCATCGTCAAATC

Site:
position = -12
score = 4.89948
sequence = GCCGTGAGGGATATGAAGGC

Gene: Cseg_0283: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Caulobacter sp. K31

Site:
position = -75
score = 4.3412
sequence = ACGTTGATGTACGTCAAATC

Site:
position = -42
score = 4.89948
sequence = GCCGTGAGGGATATGAAGGC

Gene: Caul_4506: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0542: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaD
 
Caulobacter crescentus CB15

Gene: CC3406: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0284: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Caulobacter sp. K31

Gene: Caul_4505: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_c0543: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)

Gene: PHZ_c3176: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaB
 
Caulobacter crescentus CB15

Gene: CC3405: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0285: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Caulobacter sp. K31

Gene: Caul_4504: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0544: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
 
Caulobacter crescentus CB15

Gene: CC3404: Hypothetical protein in cta-cyo gene cluster
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0286: Hypothetical protein in cta-cyo gene cluster
 
Caulobacter sp. K31

Gene: Caul_4503: Hypothetical protein in cta-cyo gene cluster
 
Phenylobacterium zucineum HLK1
Hypothetical protein in cta-cyo gene cluster
ctaG
 
Caulobacter crescentus CB15

Gene: CC3403: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0287: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Caulobacter sp. K31

Gene: Caul_4502: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0545: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
 
Caulobacter crescentus CB15

Gene: CC3402: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0288: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Caulobacter sp. K31

Gene: Caul_4501: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0546: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
CRON 5.
cydD
*
Caulobacter crescentus CB15

Site:
position = -50
score = 6.17819
sequence = TCCTTGATCCGGATCAAGGC

Gene: CC0761: ATP-binding/permease protein CydD
*
Caulobacter segnis ATCC 21756

Site:
position = -50
score = 5.75795
sequence = GCCTTGATCGTGATCAAGGA

Gene: Cseg_3606: ATP-binding/permease protein CydD
*
Caulobacter sp. K31

Site:
position = -77
score = 4.06203
sequence = CCCTATAGACGCGTCAAGGC

Site:
position = -51
score = 5.4648
sequence = GCTTTGATTGGTGTCAAGGA

Gene: Caul_0633: ATP-binding/permease protein CydD
 
Phenylobacterium zucineum HLK1
ATP-binding/permease protein CydD
cydC
 
Caulobacter crescentus CB15

Gene: CC0760: ATP-binding/permease protein CydC
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3607: ATP-binding/permease protein CydC
 
Caulobacter sp. K31

Gene: Caul_0632: ATP-binding/permease protein CydC
 
Phenylobacterium zucineum HLK1
ATP-binding/permease protein CydC
fixL
*
Caulobacter crescentus CB15

Site:
position = -37
score = 5.04113
sequence = GCCTTGACCTGGCTCAAACG

Gene: CC0759: Two-component oxygen-sensor histidine kinase FixL
*
Caulobacter segnis ATCC 21756

Site:
position = -64
score = 4.88715
sequence = GCCTTGACCTGCCTCAAACG

Gene: Cseg_3609: Two-component oxygen-sensor histidine kinase FixL
 3
Caulobacter sp. K31

Gene: Caul_2969: Two-component oxygen-sensor histidine kinase FixL

Gene: Caul_2345: Two-component oxygen-sensor histidine kinase FixL

Gene: Caul_0631: Two-component oxygen-sensor histidine kinase FixL
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_c2803: Two-component oxygen-sensor histidine kinase FixL

Gene: PHZ_p0187: Two-component oxygen-sensor histidine kinase FixL
Two-component oxygen-sensor histidine kinase FixL
fixJ
 
Caulobacter crescentus CB15

Gene: CC0758: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3610: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
 3
Caulobacter sp. K31

Gene: Caul_2968: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family

Gene: Caul_2344: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family

Gene: Caul_0630: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
 2
Phenylobacterium zucineum HLK1

Gene: PHZ_c2804: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family

Gene: PHZ_p0188: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family
fixK
*
Caulobacter crescentus CB15

Site:
position = -143
score = 5.1979
sequence = GCCTTGATCGGCGTCAAAAT

Gene: CC0752: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
*
Caulobacter segnis ATCC 21756

Site:
position = -139
score = 5.23266
sequence = ACTTTGATCCCGGTCAAAAC

Gene: Cseg_3612: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
 3
Caulobacter sp. K31

Gene: Caul_0629: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Gene: Caul_2457: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Gene: Caul_2975: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
*2
Phenylobacterium zucineum HLK1

Gene: PHZ_p0186: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family

Site:
position = -136
score = 4.95669
sequence = GATGTGACGGCGATCAAAGC

Gene: PHZ_c2798: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD