Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FnrN - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 85 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1 11 5
Loktanella vestfoldensis SKA53 10 4
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597 15 5
Oceanicola granulosus HTCC2516 1 1
Paracoccus denitrificans PD1222 14 8
Rhodobacter sphaeroides 2.4.1 20 9
Rhodobacterales bacterium HTCC2654 18 8
Roseobacter sp. MED193 17 7
Roseovarius nubinhibens ISM
Roseovarius sp. 217 19 9
Silicibacter TM1040 19 9
Silicibacter pomeroyi DSS-3 19 10
Sulfitobacter sp. EE-36 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
uspA
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
*
Loktanella vestfoldensis SKA53

Site:
position = -136
score = 5.13034
sequence = TCGTTGATGTGGATCAACCC

Site:
position = -114
score = 5.2607
sequence = CGTTTGACATGGATCAATGC

Gene: SKA53_08751: Predicted universal stress protein UspA
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
*
Oceanicola granulosus HTCC2516

Site:
position = -74
score = 5.92145
sequence = GCCTTGATCTGGATCAAGGT

Gene: OG2516_17525: Predicted universal stress protein UspA
*
Paracoccus denitrificans PD1222

Site:
position = -146
score = 5.27804
sequence = ACTTTGATCTGCGTCAATCT

Gene: Pden_1849: Predicted universal stress protein UspA
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -111
score = 5.38772
sequence = GCCTTGATCCATGTCAATGG

Site:
position = -79
score = 5.11642
sequence = TACTTGATCCTCATCAAGGA

Gene: RSP_0697: Predicted universal stress protein UspA
*
Rhodobacterales bacterium HTCC2654

Site:
position = -143
score = 5.43178
sequence = ACCTTGATCCATGTCAAAAC

Site:
position = -100
score = 5.28189
sequence = GATTTGACACATATCAAAGC

Gene: RB2654_10034: Predicted universal stress protein UspA
*
Roseobacter sp. MED193

Site:
position = -114
score = 5.52162
sequence = GCATTGATCTGCATCAAGAC

Gene: MED193_11233: Predicted universal stress protein UspA
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -111
score = 5.43901
sequence = TCCTTGATCTGTGTCAAAAC

Site:
position = -79
score = 5.40991
sequence = CGTTTGATCCGCGTCAAGGC

Gene: ROS217_12221: Predicted universal stress protein UspA
*
Silicibacter TM1040

Site:
position = -126
score = 5.39391
sequence = ACATTGATCTGTATCAAGAT

Gene: TM1040_2546: Predicted universal stress protein UspA
*
Silicibacter pomeroyi DSS-3

Site:
position = -98
score = 5.66391
sequence = GCTTTGATCTGCATCAAGAC

Gene: SPO3527: Predicted universal stress protein UspA
 
Sulfitobacter sp. EE-36
Predicted universal stress protein UspA
 
CRON 2.
ccoN
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1232: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Jannaschia sp. CCS1

Site:
position = -126
score = 5.62364
sequence = GGCTTGACCCAGATCAAGGT

Gene: Jann_3857: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Loktanella vestfoldensis SKA53

Site:
position = -105
score = 5.2607
sequence = GCATTGATCCATGTCAAACG

Site:
position = -83
score = 5.13034
sequence = GGGTTGATCCACATCAACGA

Gene: SKA53_08741: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08289: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Oceanicola batsensis HTCC2597

Site:
position = -73
score = 4.93161
sequence = CAATTGACCCAAGTCAAAAC

Gene: OB2597_20571: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -124
score = 5.27804
sequence = AGATTGACGCAGATCAAAGT

Gene: Pden_1848: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -136
score = 5.11642
sequence = TCCTTGATGAGGATCAAGTA

Site:
position = -104
score = 5.38772
sequence = CCATTGACATGGATCAAGGC

Gene: RSP_0696: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -168
score = 5.28189
sequence = GCTTTGATATGTGTCAAATC

Site:
position = -125
score = 5.43178
sequence = GTTTTGACATGGATCAAGGT

Gene: RB2654_10029: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Roseobacter sp. MED193

Site:
position = -93
score = 5.52162
sequence = GTCTTGATGCAGATCAATGC

Gene: MED193_11228: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -143
score = 5.40991
sequence = GCCTTGACGCGGATCAAACG

Site:
position = -111
score = 5.43901
sequence = GTTTTGACACAGATCAAGGA

Gene: ROS217_12226: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Silicibacter TM1040

Site:
position = -117
score = 5.39391
sequence = ATCTTGATACAGATCAATGT

Gene: TM1040_2545: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Silicibacter pomeroyi DSS-3

Site:
position = -110
score = 5.66391
sequence = GTCTTGATGCAGATCAAAGC

Gene: SPO3526: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Sulfitobacter sp. EE-36

Site:
position = -72
score = 5.72861
sequence = CATTTGATCTAGATCAAGGC

Gene: EE36_02238: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1231: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Jannaschia sp. CCS1

Gene: Jann_3856: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08736: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08294: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20576: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_1847: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0695: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_10024: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Roseobacter sp. MED193

Gene: MED193_11223: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12231: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Silicibacter TM1040

Gene: TM1040_2544: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3525: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_02233: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1230: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Jannaschia sp. CCS1

Gene: Jann_3855: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08731: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08299: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20581: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_1846: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0694: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_10019: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Roseobacter sp. MED193

Gene: MED193_11218: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12236: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Silicibacter TM1040

Gene: TM1040_2543: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3524: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_02228: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1229: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Jannaschia sp. CCS1

Gene: Jann_3854: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08726: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08304: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20586: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_1845: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0693: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_10014: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Roseobacter sp. MED193

Gene: MED193_11213: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12241: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Silicibacter TM1040

Gene: TM1040_2542: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3523: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_02223: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1228: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Jannaschia sp. CCS1

Site:
position = -84
score = 5.43887
sequence = AACTTGATCCACGTCAAAGC

Gene: Jann_3853: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Loktanella vestfoldensis SKA53

Site:
position = -177
score = 5.56421
sequence = TGCTTGATCCACATCAAGGA

Gene: SKA53_08641: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08309: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Oceanicola batsensis HTCC2597

Site:
position = -77
score = 5.70955
sequence = GCCTTGATGCAGATCAAAGG

Gene: OB2597_20591: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -70
score = 5.26945
sequence = CGCTTGACGCAGATCAATGC

Gene: Pden_1844: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0692: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Rhodobacterales bacterium HTCC2654

Site:
position = 0
score = 5.17218
sequence = ATGTTGATCCAAGTCAAGGC

Gene: RB2654_10004: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Roseobacter sp. MED193

Site:
position = -180
score = 5.42996
sequence = TTTTTGATCCACGTCAAAGA

Gene: MED193_11193: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -73
score = 5.45265
sequence = AATTTGATGCAGGTCAAAGC

Gene: ROS217_12261: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Silicibacter TM1040

Site:
position = -79
score = 5.42274
sequence = TTTTTGATCCACGTCAAAGT

Gene: TM1040_2540: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Silicibacter pomeroyi DSS-3

Site:
position = -80
score = 5.4002
sequence = TTTTTGACCCATATCAAAGT

Gene: SPO3522: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Sulfitobacter sp. EE-36

Site:
position = -74
score = 5.63715
sequence = TGTTTGATGCAGATCAAAGC

Gene: EE36_02218: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1227: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Jannaschia sp. CCS1

Gene: Jann_3852: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08646: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08314: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20596: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_1843: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0691: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09999: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Roseobacter sp. MED193

Gene: MED193_11188: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12266: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Silicibacter TM1040

Gene: TM1040_2539: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Silicibacter pomeroyi DSS-3

Gene: SPO3521: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Sulfitobacter sp. EE-36

Gene: EE36_02213: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1226: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Jannaschia sp. CCS1

Gene: Jann_3851: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08651: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08319: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20601: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_1842: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0690: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09994: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Roseobacter sp. MED193

Gene: MED193_11183: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12271: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Silicibacter TM1040

Gene: TM1040_2538: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3520: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Sulfitobacter sp. EE-36

Gene: EE36_02208: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1225: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Jannaschia sp. CCS1

Gene: Jann_3850: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08656: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08324: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Oceanicola batsensis HTCC2597

Gene: OB2597_20606: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_1841: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_0689: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_09989: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Roseobacter sp. MED193

Gene: MED193_11178: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_12276: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Silicibacter TM1040

Gene: TM1040_2537: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Silicibacter pomeroyi DSS-3

Gene: SPO3519: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Sulfitobacter sp. EE-36

Gene: EE36_02203: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
CRON 3.
ctaD
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1039: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Jannaschia sp. CCS1

Gene: Jann_1250: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_06992: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_13995: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Oceanicola batsensis HTCC2597

Site:
position = -113
score = 5.17196
sequence = TATTTGATCTGCGTCAATAC

Gene: OB2597_06915: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_07320: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 2
Paracoccus denitrificans PD1222

Gene: Pden_1938: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)

Gene: Pden_3028: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -127
score = 5.61574
sequence = TTATTGATCCAGATCAAAGT

Gene: RSP_1877: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -212
score = 5.59745
sequence = TCCTTGACCCGGATCAAACA

Gene: RB2654_08222: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Roseobacter sp. MED193

Site:
position = -122
score = 5.59622
sequence = ATCTTGATCCAGATCAAACT

Gene: MED193_08728: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_04945: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Roseovarius sp. 217

Site:
position = -128
score = 5.422
sequence = TCTTTGATCTGCATCAATTT

Gene: ROS217_15111: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Silicibacter TM1040

Site:
position = -125
score = 5.60344
sequence = TTCTTGATCCAGATCAAACT

Gene: TM1040_2291: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
*
Silicibacter pomeroyi DSS-3

Site:
position = -120
score = 5.59622
sequence = ATCTTGATCCAGATCAAACT

Gene: SPO1383: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_17347: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
CRON 4.
ctaC
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1038: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Jannaschia sp. CCS1

Gene: Jann_3155: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08421: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_13990: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Oceanicola batsensis HTCC2597

Site:
position = -189
score = 5.60585
sequence = TTCTTGATCCAGATCAAAAA

Gene: OB2597_15845: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4321: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -161
score = 5.47438
sequence = TCCTTGATTCAGATCAAATG

Gene: RSP_1826: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -192
score = 5.29795
sequence = GCATTGATCTGCATCAATCG

Gene: RB2654_06514: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Roseobacter sp. MED193

Site:
position = -178
score = 5.40066
sequence = TTTTTGATCTAAATCAAGAA

Gene: MED193_08963: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_03125: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Roseovarius sp. 217

Site:
position = -219
score = 5.18475
sequence = AATTTGATTTAAATCAAAAA

Gene: ROS217_04445: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Silicibacter TM1040

Site:
position = -164
score = 5.24366
sequence = TTTTTGATCTAAGTCAAGAA

Gene: TM1040_2336: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Silicibacter pomeroyi DSS-3

Site:
position = -162
score = 5.62445
sequence = TGTTTGATCCAGATCAAAAA

Gene: SPO3076: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_09905: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaB
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1040: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Jannaschia sp. CCS1

Gene: Jann_3154: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08416: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_14006: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Oceanicola batsensis HTCC2597

Gene: OB2597_15850: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4320: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1827: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06509: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Roseobacter sp. MED193

Gene: MED193_08958: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Roseovarius nubinhibens ISM

Gene: ISM_03120: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Roseovarius sp. 217

Gene: ROS217_04440: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Silicibacter TM1040

Gene: TM1040_2335: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Silicibacter pomeroyi DSS-3

Gene: SPO3075: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Sulfitobacter sp. EE-36

Gene: EE36_09910: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1041: Hypothetical protein in cta gene cluster
 
Jannaschia sp. CCS1

Gene: Jann_3153: Hypothetical protein in cta gene cluster
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08411: Hypothetical protein in cta gene cluster
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_14011: Hypothetical protein in cta gene cluster
 
Oceanicola batsensis HTCC2597

Gene: OB2597_15855: Hypothetical protein in cta gene cluster
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4319: Hypothetical protein in cta gene cluster
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_6021: Hypothetical protein in cta gene cluster
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06504: Hypothetical protein in cta gene cluster
 
Roseobacter sp. MED193

Gene: MED193_08953: Hypothetical protein in cta gene cluster
 
Roseovarius nubinhibens ISM

Gene: ISM_03115: Hypothetical protein in cta gene cluster
 
Roseovarius sp. 217

Gene: ROS217_04435: Hypothetical protein in cta gene cluster
 
Silicibacter TM1040

Gene: TM1040_2334: Hypothetical protein in cta gene cluster
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36

Gene: EE36_09915: Hypothetical protein in cta gene cluster
Hypothetical protein in cta gene cluster
ctaG
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1042: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Jannaschia sp. CCS1

Gene: Jann_3152: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08406: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_14016: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Oceanicola batsensis HTCC2597

Gene: OB2597_15860: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4318: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1828: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06499: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Roseobacter sp. MED193

Gene: MED193_08948: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Roseovarius nubinhibens ISM

Gene: ISM_03110: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Roseovarius sp. 217

Gene: ROS217_04430: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Silicibacter TM1040

Gene: TM1040_2333: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Silicibacter pomeroyi DSS-3

Gene: SPO3074: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Sulfitobacter sp. EE-36

Gene: EE36_09920: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_1043: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Jannaschia sp. CCS1

Gene: Jann_3151: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08401: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_14021: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_15865: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_4317: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_1829: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_06494: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Roseobacter sp. MED193

Gene: MED193_08943: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_03105: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Roseovarius sp. 217

Gene: ROS217_04425: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Silicibacter TM1040

Gene: TM1040_2332: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3073: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_09925: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
CRON 5.
fnrN
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -56
score = 5.39772
sequence = GCATTGATTTGGATCAAGCG

Gene: Jann_3858: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08756: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516

Gene: OG2516_17530: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Paracoccus denitrificans PD1222

Site:
position = -131
score = 5.31016
sequence = ACCTTGACCCAAATCAAATG

Gene: Pden_1850: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -31
score = 5.54002
sequence = GCTTTGATTCAGATCAAGCG

Gene: RSP_0698: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Rhodobacterales bacterium HTCC2654

Site:
position = -29
score = 5.34302
sequence = ACATTGATACGGATCAAATG

Gene: RB2654_10044: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Roseobacter sp. MED193

Site:
position = -29
score = 5.34421
sequence = ACTTTGACTTGGATCAAACG

Gene: MED193_11238: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -53
score = 5.30224
sequence = GCTTTGATTTAGATCAACCG

Gene: ROS217_12216: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Silicibacter TM1040

Site:
position = -29
score = 5.20421
sequence = GCTTTGACACAGATCAACCA

Gene: TM1040_2547: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Silicibacter pomeroyi DSS-3

Site:
position = -32
score = 5.35098
sequence = ACCTTGACTCAGATCAAGTA

Gene: SPO3531: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Sulfitobacter sp. EE-36

Gene: EE36_11304: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
CRON 6.
hemA
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2062: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Jannaschia sp. CCS1

Site:
position = -67
score = 5.90163
sequence = CCTTTGATCCAGATCAAAGC

Gene: Jann_1933: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Loktanella vestfoldensis SKA53

Site:
position = -167
score = 4.92982
sequence = TTATTGATCCAGATCATGGT

Gene: SKA53_02751: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_01936: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Oceanicola batsensis HTCC2597

Site:
position = -155
score = 5.25378
sequence = GAATTGATTCACATCAAGGA

Gene: OB2597_01932: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_03560: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Paracoccus denitrificans PD1222

Site:
position = -40
score = 5.39969
sequence = GGCTTGATGCGTATCAAGGT

Gene: Pden_1822: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -87
score = 5.19841
sequence = GATTTGATCCTTATCAAGGC

Gene: RSP_2984: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -127
score = 5.27211
sequence = GGTTTGATCCACGTCAACGC

Gene: RB2654_03389: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Roseobacter sp. MED193

Site:
position = -162
score = 5.38476
sequence = TATTTGACCTGTATCAAAGT

Gene: MED193_21064: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Roseovarius nubinhibens ISM

Gene: ISM_15170: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Roseovarius sp. 217

Site:
position = -168
score = 5.24657
sequence = GACTTGACCCAAGTCAAGGA

Gene: ROS217_21737: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Silicibacter TM1040

Site:
position = -169
score = 5.37819
sequence = TATTTGACCTGTATCAAGGA

Gene: TM1040_0860: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Silicibacter pomeroyi DSS-3

Site:
position = -146
score = 5.11806
sequence = TAATTGACCCAAGTCAAGGC

Gene: SPO2596: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Sulfitobacter sp. EE-36

Gene: EE36_14417: 5-aminolevulinate synthase (EC 2.3.1.37)
5-aminolevulinate synthase (EC 2.3.1.37)
 
CRON 7.
hemN
 
Hyphomonas neptunium ATCC 15444
*
Jannaschia sp. CCS1

Site:
position = -51
score = 5.39772
sequence = CGCTTGATCCAAATCAATGC

Gene: Jann_3859: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -51
score = 5.31016
sequence = CATTTGATTTGGGTCAAGGT

Gene: Pden_1851: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -51
score = 5.54002
sequence = CGCTTGATCTGAATCAAAGC

Gene: RSP_0699: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Rhodobacterales bacterium HTCC2654

Site:
position = -52
score = 5.34302
sequence = CATTTGATCCGTATCAATGT

Gene: RB2654_10049: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Roseobacter sp. MED193

Gene: MED193_11243: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -51
score = 5.30224
sequence = CGGTTGATCTAAATCAAAGC

Gene: ROS217_12211: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Silicibacter TM1040

Site:
position = -51
score = 5.20421
sequence = TGGTTGATCTGTGTCAAAGC

Gene: TM1040_2548: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Silicibacter pomeroyi DSS-3

Site:
position = -52
score = 5.35098
sequence = TACTTGATCTGAGTCAAGGT

Gene: SPO3532: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Sulfitobacter sp. EE-36
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
CRON 8.
ompW
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -51
score = 5.48362
sequence = ATCTTGATCCAGATCAACGT

Gene: Pden_3636: Outer membrane protein W precursor
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -69
score = 5.41025
sequence = CCATTGACGCAGATCAAGGC

Gene: RSP_2507: Outer membrane protein W precursor
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
*
Roseovarius sp. 217

Site:
position = -75
score = 5.21525
sequence = AACTTGACCCAAATCAATGT

Gene: ROS217_20807: Outer membrane protein W precursor
*
Silicibacter TM1040

Site:
position = -78
score = 5.21265
sequence = CATTTGATCTAGATCAGAGC

Gene: TM1040_0734: Outer membrane protein W precursor
*
Silicibacter pomeroyi DSS-3

Site:
position = -75
score = 5.20071
sequence = ATCTTGATCCAGATCAGGGA

Gene: SPO2792: Outer membrane protein W precursor
 
Sulfitobacter sp. EE-36
Outer membrane protein W precursor
 
CRON 9.
ccpR
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
*
Paracoccus denitrificans PD1222

Site:
position = -141
score = 5.05381
sequence = CATCTGACCCAGATCAAAGC

Gene: Pden_0893: Cytochrome c551 peroxidase (EC 1.11.1.5)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -81
score = 5.23608
sequence = GAATTGATCTAAGTCAAAGG

Gene: RSP_2395: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217

Gene: ROS217_11501: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Silicibacter TM1040
*
Silicibacter pomeroyi DSS-3

Site:
position = -96
score = 5.49363
sequence = CGCTTGATCCATATCAAAGT

Gene: SPO0330: Cytochrome c551 peroxidase (EC 1.11.1.5)
 
Sulfitobacter sp. EE-36
Cytochrome c551 peroxidase (EC 1.11.1.5)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD