Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FnrN - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator (repressor)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1 12 5
Novosphingobium aromaticivorans DSM 12444 12 5
Sphingobium japonicum UT26S 10 3
Sphingomonas wittichii RW1 7 1
Sphingopyxis alaskensis RB2256 11 4
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ccoN
 
Erythrobacter litoralis HTCC2594
*
Erythrobacter sp. NAP1

Site:
position = -72
score = 4.55505
sequence = AACTTGATCTGAGTCAAACA

Gene: NAP1_15803: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -144
score = 4.63311
sequence = ACATTGACGGAGCGCAAAAA

Site:
position = -77
score = 4.9263
sequence = TATTTGACAAGGGTCAATGT

Gene: Saro_2578: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Sphingobium japonicum UT26S

Site:
position = -74
score = 5.54064
sequence = GCTTTGACAGAGGTCAATGC

Gene: SJA_C2-00670: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Sphingomonas wittichii RW1

Site:
position = -200
score = 5.13916
sequence = GATTTGATCTGGCGCAAGGC

Gene: Swit_1801: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Sphingopyxis alaskensis RB2256

Site:
position = -112
score = 4.61486
sequence = GCATTGATGGAGCGCAAGCA

Site:
position = -90
score = 5.28227
sequence = TCGTTGATCCCGGTCAATGT

Gene: Sala_1676: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Zymomonas mobilis subsp. mobilis ZM4
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15808: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2577: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00680: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Sphingomonas wittichii RW1

Gene: Swit_1800: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1675: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Zymomonas mobilis subsp. mobilis ZM4
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15813: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2576: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00690: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Sphingomonas wittichii RW1

Gene: Swit_1799: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1674: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Zymomonas mobilis subsp. mobilis ZM4
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15818: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2575: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00700: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Sphingomonas wittichii RW1

Gene: Swit_1798: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1673: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Zymomonas mobilis subsp. mobilis ZM4
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15823: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2574: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00710: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1672: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Zymomonas mobilis subsp. mobilis ZM4
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15828: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2573: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00720: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Sphingomonas wittichii RW1
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1671: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Zymomonas mobilis subsp. mobilis ZM4
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15833: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2572: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00730: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Sphingomonas wittichii RW1

Gene: Swit_1796: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1670: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Zymomonas mobilis subsp. mobilis ZM4
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15838: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2571: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00740: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Sphingomonas wittichii RW1

Gene: Swit_1795: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1669: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Zymomonas mobilis subsp. mobilis ZM4
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoX
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1

Gene: Swit_1797: Predicted integral membrane protein CcoX
 
Sphingopyxis alaskensis RB2256
 
Zymomonas mobilis subsp. mobilis ZM4
Predicted integral membrane protein CcoX
 
CRON 2.
hemN
 
Erythrobacter litoralis HTCC2594
*
Erythrobacter sp. NAP1

Site:
position = -52
score = 5.26251
sequence = GATTTGATCTGGCGCAAAGA

Gene: NAP1_15848: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -68
score = 4.87096
sequence = AATTTGCCATATCTCAATGC

Gene: Saro_2569: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00620: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Sphingomonas wittichii RW1
*
Sphingopyxis alaskensis RB2256

Site:
position = -51
score = 4.80294
sequence = CCGTTGATGCCGATCAATGC

Gene: Sala_1668: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Zymomonas mobilis subsp. mobilis ZM4
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
CRON 3.
uspA
 
Erythrobacter litoralis HTCC2594
*
Erythrobacter sp. NAP1

Site:
position = -70
score = 5.45064
sequence = AAATTGATCTGGATCAATGC

Gene: NAP1_01820: Predicted universal stress protein UspA
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -71
score = 4.29768
sequence = AATTTGACGTGGATCATGGT

Gene: Saro_0571: Predicted universal stress protein UspA
 
Sphingobium japonicum UT26S

Gene: SJA_C2-00480: Predicted universal stress protein UspA
 
Sphingomonas wittichii RW1

Gene: Swit_0266: Predicted universal stress protein UspA
*
Sphingopyxis alaskensis RB2256

Site:
position = -69
score = 4.78115
sequence = GATTTGATGCGAATCAATGA

Gene: Sala_1679: Predicted universal stress protein UspA
 
Zymomonas mobilis subsp. mobilis ZM4
Predicted universal stress protein UspA
 
CRON 4.
fnrN
 
Erythrobacter litoralis HTCC2594

Gene: ELI_02800: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Erythrobacter sp. NAP1

Site:
position = -3
score = 5.72965
sequence = GCATTGATCCAGGTCAATGC

Gene: NAP1_15798: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -232
score = 4.64859
sequence = GTTTTGACATCCGTCAACGC

Gene: Saro_2581: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Sphingobium japonicum UT26S

Site:
position = 10
score = 4.55827
sequence = GATTTGATCTGGCGCAAAAG

Gene: SJA_C2-00660: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Sphingomonas wittichii RW1

Gene: Swit_1945: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Sphingopyxis alaskensis RB2256

Gene: Sala_1678: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Zymomonas mobilis subsp. mobilis ZM4
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
CRON 5.
ompW
 
Erythrobacter litoralis HTCC2594
*
Erythrobacter sp. NAP1

Site:
position = -238
score = 5.72965
sequence = GCATTGACCTGGATCAATGC

Gene: NAP1_15793: Outer membrane protein W precursor
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -179
score = 4.9263
sequence = ACATTGACCCTTGTCAAATA

Site:
position = -112
score = 4.63311
sequence = TTTTTGCGCTCCGTCAATGT

Gene: Saro_2579: Outer membrane protein W precursor
*
Sphingobium japonicum UT26S

Site:
position = -103
score = 5.35119
sequence = ACATTGAGCCAGGTCAAATT

Site:
position = -81
score = 4.46499
sequence = CGGTTGCGCGGGATCAATGC

Gene: SJA_C2-00650: Outer membrane protein W precursor
 
Sphingomonas wittichii RW1
*
Sphingopyxis alaskensis RB2256

Site:
position = -97
score = 5.28227
sequence = ACATTGACCGGGATCAACGA

Site:
position = -75
score = 4.61486
sequence = TGCTTGCGCTCCATCAATGC

Gene: Sala_1677: Outer membrane protein W precursor
 
Zymomonas mobilis subsp. mobilis ZM4
Outer membrane protein W precursor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD