Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecium DO 8 5
Enterococcus faecalis V583 16 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpsN2
*2
Enterococcus faecium DO

Gene: EfaeDRAFT_0071: SSU ribosomal protein S14p

Site:
position = -55
score = 6.79418
sequence = AAAAGCGTAAAGATTACGATTTA

Gene: EfaeDRAFT_0070: SSU ribosomal protein S14p
*2
Enterococcus faecalis V583

Site:
position = -57
score = 7.13691
sequence = CAAATCGTAACCATTACGATTTA

Gene: EF3202: SSU ribosomal protein S14p

Site:
position = -60
score = 6.92532
sequence = CAAAACGTAACGTTTACGATTTG

Gene: EF0585: SSU ribosomal protein S14p
SSU ribosomal protein S14p
rpmG2
 
Enterococcus faecium DO
 2
Enterococcus faecalis V583

Gene: EF0588: LSU ribosomal protein L33p

Gene: EF3203: LSU ribosomal protein L33p
LSU ribosomal protein L33p
yciC
 
Enterococcus faecium DO
 2
Enterococcus faecalis V583

Gene: EF3204: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Gene: EF0589: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
EfaeDRAFT_0933
*
Enterococcus faecium DO

Site:
position = -69
score = 6.85637
sequence = CAAATCGTAATTGTTTCGATTTG

Gene: EfaeDRAFT_0933: conserved hypothetical protein
 
Enterococcus faecalis V583

Gene: EF3205: conserved hypothetical protein
conserved hypothetical protein
zinT
*
Enterococcus faecium DO

Site:
position = -78
score = 6.71205
sequence = TAAAACGTAACTATTACGGTTTG

Gene: EfaeDRAFT_2092: zinc-binding lipoprotein ZinT
 
Enterococcus faecalis V583

Gene: EF3206: zinc-binding lipoprotein ZinT
Candidate zinc-binding lipoprotein ZinT
rpmF2
 
Enterococcus faecium DO
*2
Enterococcus faecalis V583

Site:
position = -122
score = 7.29866
sequence = CAAAACGTAATCATTACGATTTG

Gene: EF0544: LSU ribosomal protein L32p

Gene: EF0586: LSU ribosomal protein L32p
LSU ribosomal protein L32p
EF0587
 
Enterococcus faecium DO
 2
Enterococcus faecalis V583

Gene: EF0587: hypothetical protein

Gene: EF0545: hypothetical protein
hypothetical protein
 
CRON 2.
znuA
*
Enterococcus faecium DO

Site:
position = -150
score = 4.64733
sequence = CAACTCATCCATTTTACGATTTA

Gene: EfaeDRAFT_1581: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Enterococcus faecalis V583

Site:
position = -52
score = 6.78841
sequence = CAAATCGTAAATATTACGGTTTA

Gene: EF0055: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
*
Enterococcus faecium DO

Site:
position = -39
score = 4.3829
sequence = AAGAAAGTATCAATTAAGTTTTA

Gene: EfaeDRAFT_1582: Zinc ABC transporter, ATP-binding protein ZnuC
 
Enterococcus faecalis V583

Gene: EF0056: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Enterococcus faecium DO

Gene: EfaeDRAFT_1583: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Enterococcus faecalis V583

Gene: EF0057: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 3.
zur
*
Enterococcus faecium DO

Site:
position = -35
score = 6.07968
sequence = TACTTCGTAATCATTTTGATTTG

Gene: EfaeDRAFT_1775: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Enterococcus faecalis V583

Site:
position = -46
score = 5.96081
sequence = TATTTCGTAATGATTCTGATTTA

Gene: EF2417: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD