Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TtrR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: LuxR
Regulation mode: activator
Biological process: Tetrathionate reduction
Effector: Tetrathionate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202 5 2
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320 5 2
Salmonella typhimurium LT2 5 2
Serratia proteamaculans 568 5 2
Yersinia pestis KIM
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ttrB
 
Citrobacter koseri ATCC BAA-895
*
Edwardsiella tarda EIB202

Site:
position = -131
score = 6.65743
sequence = GCTATTGTGGTTTTCCACAATAGG

Gene: ETAE_1647: Tetrathionate reductase, subunit B
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
*
Proteus mirabilis HI4320

Site:
position = -121
score = 6.52334
sequence = GAGTATGTGGTAAACCACAATAGG

Gene: PMI1683: Tetrathionate reductase, subunit B
*
Salmonella typhimurium LT2

Site:
position = -118
score = 6.50818
sequence = GGGTATGTGGTTAACCACAATAGA

Gene: STM1385: Tetrathionate reductase, subunit B
*
Serratia proteamaculans 568

Site:
position = -92
score = 6.49378
sequence = GGGAATGTGGTAAACCACAATATT

Gene: Spro_1067: Tetrathionate reductase, subunit B
 
Yersinia pestis KIM
Tetrathionate reductase, subunit B
ttrC
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202

Gene: ETAE_1648: Tetrathionate reductase subunit C
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320

Gene: PMI1682: Tetrathionate reductase subunit C
 
Salmonella typhimurium LT2

Gene: STM1384: Tetrathionate reductase subunit C
 
Serratia proteamaculans 568

Gene: Spro_1068: Tetrathionate reductase subunit C
 
Yersinia pestis KIM
Tetrathionate reductase subunit C
ttrA
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202

Gene: ETAE_1649: Tetrathionate reductase subunit A
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320

Gene: PMI1681: Tetrathionate reductase subunit A
 
Salmonella typhimurium LT2

Gene: STM1383: Tetrathionate reductase subunit A
 
Serratia proteamaculans 568

Gene: Spro_1069: Tetrathionate reductase subunit A
 
Yersinia pestis KIM
Tetrathionate reductase subunit A
 
CRON 2.
ttrS
 
Citrobacter koseri ATCC BAA-895
*
Edwardsiella tarda EIB202

Site:
position = -85
score = 6.65743
sequence = CCTATTGTGGAAAACCACAATAGC

Gene: ETAE_1646: Tetrathionate reduction sensor protein TtrS
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
*
Proteus mirabilis HI4320

Site:
position = -66
score = 6.52334
sequence = CCTATTGTGGTTTACCACATACTC

Gene: PMI1684: Tetrathionate reduction sensor protein TtrS
*
Salmonella typhimurium LT2

Site:
position = -69
score = 6.50818
sequence = TCTATTGTGGTTAACCACATACCC

Gene: STM1386: Tetrathionate reduction sensor protein TtrS
*
Serratia proteamaculans 568

Site:
position = -85
score = 6.49378
sequence = AATATTGTGGTTTACCACATTCCC

Gene: Spro_1066: Tetrathionate reduction sensor protein TtrS
 
Yersinia pestis KIM
Tetrathionate reduction sensor protein TtrS
ttrR
 
Citrobacter koseri ATCC BAA-895
 
Edwardsiella tarda EIB202

Gene: ETAE_1645: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Escherichia coli str. K-12 substr. MG1655
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Photorhabdus luminescens subsp. laumondii TTO1
 
Proteus mirabilis HI4320

Gene: PMI1685: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Salmonella typhimurium LT2

Gene: STM1387: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Serratia proteamaculans 568

Gene: Spro_1065: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Yersinia pestis KIM
Tetrathionate reduction response regulator protein TtrR, LuxR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD