Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TtrR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: LuxR
Regulation mode: activator
Biological process: Tetrathionate reduction
Effector: Tetrathionate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Actinobacillus succinogenes 130Z
Aggregatibacter aphrophilus NJ8700
Haemophilus ducreyi 35000HP
Haemophilus influenzae Rd KW20
Haemophilus parasuis SH0165
Haemophilus somnus 2336 5 2
Mannheimia succiniciproducens MBEL55E
Pasteurella multocida subsp. multocida str. Pm70 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ttrS
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
*
Haemophilus somnus 2336

Site:
position = -96
score = 6.36808
sequence = ACCATTGTGGTTTTCCACATAAAA

Gene: HSM_1378: Tetrathionate reduction sensor protein TtrS
 
Mannheimia succiniciproducens MBEL55E
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -64
score = 6.53341
sequence = ACTATTGTGGTTTTCCACATAAAC

Gene: PM0724: Tetrathionate reduction sensor protein TtrS
Tetrathionate reduction sensor protein TtrS
ttrR
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336

Gene: HSM_1379: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Mannheimia succiniciproducens MBEL55E
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0725: Tetrathionate reduction response regulator protein TtrR, LuxR family
Tetrathionate reduction response regulator protein TtrR, LuxR family
 
CRON 2.
ttrB
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
*
Haemophilus somnus 2336

Site:
position = -179
score = 6.36808
sequence = TTTTATGTGGAAAACCACAATGGT

Gene: HSM_1377: Tetrathionate reductase subunit B
 
Mannheimia succiniciproducens MBEL55E
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -107
score = 6.53341
sequence = GTTTATGTGGAAAACCACAATAGT

Gene: PM0723: Tetrathionate reductase subunit B
Tetrathionate reductase subunit B
ttrC
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336

Gene: HSM_1376: Tetrathionate reductase subunit C
 
Mannheimia succiniciproducens MBEL55E
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0722: Tetrathionate reductase subunit C
Tetrathionate reductase subunit C
ttrA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336

Gene: HSM_1375: Tetrathionate reductase subunit A
 
Mannheimia succiniciproducens MBEL55E
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0721: Tetrathionate reductase subunit A
Tetrathionate reductase subunit A
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD