Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TtrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: LuxR
Regulation mode:
Biological process: Tetrathionate reduction
Effector: Tetrathionate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella amazonensis SB2B
Shewanella baltica OS155 5 2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella halifaxensis HAW-EB4
Shewanella loihica PV-4
Shewanella oneidensis MR-1
Shewanella pealeana ATCC 700345
Shewanella piezotolerans WP3
Shewanella putrefaciens CN-32 5 2
Shewanella sediminis HAW-EB3
Shewanella sp ANA-3 5 2
Shewanella sp MR-4 5 2
Shewanella sp MR-7
Shewanella sp W3-18-1 5 2
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ttrB
 
Shewanella amazonensis SB2B
*
Shewanella baltica OS155

Site:
position = -130
score = 5.96429
sequence = TGATATGTGGAAAACCACTATAGT

Gene: Sbal_0591: Tetrathionate reductase subunit B
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4
 
Shewanella loihica PV-4
 
Shewanella oneidensis MR-1
 
Shewanella pealeana ATCC 700345
 
Shewanella piezotolerans WP3
*
Shewanella putrefaciens CN-32

Site:
position = -130
score = 6.05628
sequence = CGATATGTGGAAAACCACTATAGT

Gene: Sputcn32_0664: Tetrathionate reductase subunit B
 
Shewanella sediminis HAW-EB3
*
Shewanella sp ANA-3

Site:
position = -131
score = 5.88118
sequence = CGCTATGTGGAAAACCACTATAGT

Gene: Shewana3_0635: Tetrathionate reductase subunit B
*
Shewanella sp MR-4

Site:
position = -112
score = 5.96429
sequence = CGATATGTGGAAAACCACTATAGA

Gene: Shewmr4_0635: Tetrathionate reductase subunit B
 
Shewanella sp MR-7
*
Shewanella sp W3-18-1

Site:
position = -131
score = 6.05628
sequence = CGATATGTGGAAAACCACTATAGT

Gene: Sputw3181_3510: Tetrathionate reductase subunit B
 
Shewanella woodyi ATCC 51908
Tetrathionate reductase subunit B
ttrC
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155

Gene: Sbal_0590: Tetrathionate reductase subunit C
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4
 
Shewanella loihica PV-4
 
Shewanella oneidensis MR-1
 
Shewanella pealeana ATCC 700345
 
Shewanella piezotolerans WP3
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0663: Tetrathionate reductase subunit C
 
Shewanella sediminis HAW-EB3
 
Shewanella sp ANA-3

Gene: Shewana3_0634: Tetrathionate reductase subunit C
 
Shewanella sp MR-4

Gene: Shewmr4_0634: Tetrathionate reductase subunit C
 
Shewanella sp MR-7
 
Shewanella sp W3-18-1

Gene: Sputw3181_3511: Tetrathionate reductase subunit C
 
Shewanella woodyi ATCC 51908
Tetrathionate reductase subunit C
ttrA
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155

Gene: Sbal_0589: Tetrathionate reductase subunit A
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4
 
Shewanella loihica PV-4
 
Shewanella oneidensis MR-1
 
Shewanella pealeana ATCC 700345
 
Shewanella piezotolerans WP3
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0662: Tetrathionate reductase subunit A
 
Shewanella sediminis HAW-EB3
 
Shewanella sp ANA-3

Gene: Shewana3_0633: Tetrathionate reductase subunit A
 
Shewanella sp MR-4

Gene: Shewmr4_0633: Tetrathionate reductase subunit A
 
Shewanella sp MR-7
 
Shewanella sp W3-18-1

Gene: Sputw3181_3512: Tetrathionate reductase subunit A
 
Shewanella woodyi ATCC 51908
Tetrathionate reductase subunit A
 
CRON 2.
ttrS
 
Shewanella amazonensis SB2B
*
Shewanella baltica OS155

Site:
position = -299
score = 5.96429
sequence = ACTATAGTGGTTTTCCACATATCA

Gene: Sbal_0592: Tetrathionate reduction sensor protein TtrS
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4
 
Shewanella loihica PV-4
 
Shewanella oneidensis MR-1
 
Shewanella pealeana ATCC 700345
 
Shewanella piezotolerans WP3
*
Shewanella putrefaciens CN-32

Site:
position = -174
score = 6.05628
sequence = ACTATAGTGGTTTTCCACATATCG

Gene: Sputcn32_0665: Tetrathionate reduction sensor protein TtrS
 
Shewanella sediminis HAW-EB3
*
Shewanella sp ANA-3

Site:
position = -147
score = 5.88118
sequence = ACTATAGTGGTTTTCCACATAGCG

Gene: Shewana3_0636: Tetrathionate reduction sensor protein TtrS
*
Shewanella sp MR-4

Site:
position = -129
score = 5.96429
sequence = TCTATAGTGGTTTTCCACATATCG

Gene: Shewmr4_0636: Tetrathionate reduction sensor protein TtrS
 
Shewanella sp MR-7
*
Shewanella sp W3-18-1

Site:
position = -198
score = 6.05628
sequence = ACTATAGTGGTTTTCCACATATCG

Gene: Sputw3181_3509: Tetrathionate reduction sensor protein TtrS
 
Shewanella woodyi ATCC 51908
Tetrathionate reduction sensor protein TtrS
ttrR
 
Shewanella amazonensis SB2B
 
Shewanella baltica OS155

Gene: Sbal_0593: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella halifaxensis HAW-EB4
 
Shewanella loihica PV-4
 
Shewanella oneidensis MR-1
 
Shewanella pealeana ATCC 700345
 
Shewanella piezotolerans WP3
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0666: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Shewanella sediminis HAW-EB3
 
Shewanella sp ANA-3

Gene: Shewana3_0637: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Shewanella sp MR-4

Gene: Shewmr4_0637: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Shewanella sp MR-7
 
Shewanella sp W3-18-1

Gene: Sputw3181_3508: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Shewanella woodyi ATCC 51908
Tetrathionate reduction response regulator protein TtrR, LuxR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD