Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TtrR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LuxR
Regulation mode:
Biological process: Tetrathionate reduction
Effector: Tetrathionate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 3 2
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633 3 2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1 5 2
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ttrS
*
Photobacterium profundum SS9

Site:
position = -175
score = 5.98919
sequence = CCTATTGTGGTTTTCCACATACCC

Gene: PBPRB0007: Tetrathionate reduction sensor protein TtrS
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -215
score = 6.40982
sequence = GATATAGTGGATTTCCACATACCC

Gene: VP2010: Tetrathionate reduction sensor protein TtrS
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -110
score = 6.21256
sequence = GATATAGTGGATTTCCACATACCA

Gene: VSAK1_06450: Tetrathionate reduction sensor protein TtrS
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Tetrathionate reduction sensor protein TtrS
ttrR
 
Photobacterium profundum SS9

Gene: PBPRB0008: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2009: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_06445: Tetrathionate reduction response regulator protein TtrR, LuxR family
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Tetrathionate reduction response regulator protein TtrR, LuxR family
 
CRON 2.
ttrC
*
Photobacterium profundum SS9

Site:
position = -106
score = 5.98919
sequence = GGGTATGTGGAAAACCACAATAGG

Gene: PBPRB0006: Tetrathionate reductase subunit B
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -89
score = 6.40982
sequence = GGGTATGTGGAAATCCACTATATC

Gene: VP2011: Tetrathionate reductase subunit B
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -84
score = 6.21256
sequence = TGGTATGTGGAAATCCACTATATC

Gene: VSAK1_06455: Tetrathionate reductase subunit B
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Tetrathionate reductase subunit B
ttrC
 
Photobacterium profundum SS9

Gene: PBPRB0004: Tetrathionate reductase subunit C
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2013: Tetrathionate reductase subunit C
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_06460: Tetrathionate reductase subunit C
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Tetrathionate reductase subunit C
ttrA
 
Photobacterium profundum SS9

Gene: PBPRB0003: Tetrathionate reductase subunit A
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2014: Tetrathionate reductase subunit A
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_06465: Tetrathionate reductase subunit A
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
Tetrathionate reductase subunit A
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD