Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AgaR2 - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylgalactosamine utilization
Effector: N-acetylgalactosamine-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecalis V583 9 1
Enterococcus faecium DO 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
agaR2
*
Enterococcus faecalis V583

Site:
position = -37
score = 5.50189
sequence = TTTGTGGTTATAACCAGTTA

Gene: EF1809: N-acetylgalactosamine utilization transcriptional regulator AgaR2, GntR family
*
Enterococcus faecium DO

Site:
position = -32
score = 4.96655
sequence = ATTGTGGTTATAGCCAGTTA

Gene: EfaeDRAFT_2711: N-acetylgalactosamine utilization transcriptional regulator AgaR2, GntR family
N-acetylgalactosamine utilization transcriptional regulator AgaR2, GntR family
agaS
 
Enterococcus faecalis V583

Gene: EF1808: Predicted galactosamine-6-phosphate isomerase (EC 5.3.1.-)
 
Enterococcus faecium DO

Gene: EfaeDRAFT_2712: Predicted galactosamine-6-phosphate isomerase (EC 5.3.1.-)
Predicted galactosamine-6-phosphate isomerase (EC 5.3.1.-)
agaY
 
Enterococcus faecalis V583

Gene: EF1807: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
Enterococcus faecium DO

Gene: EfaeDRAFT_2713: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
agaZ
 
Enterococcus faecalis V583

Gene: EF1806: Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
 
Enterococcus faecium DO
Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
bgaC
 
Enterococcus faecalis V583

Gene: EF1805: Beta-galactosidase (EC 3.2.1.23)
 
Enterococcus faecium DO

Gene: EfaeDRAFT_0627: Beta-galactosidase (EC 3.2.1.23)
Beta-galactosidase (EC 3.2.1.23)
gadV
 2
Enterococcus faecalis V583

Gene: EF1804: Predicted galactosamine disaccharide-specific PTS, EIIB component (EC 2.7.1.69)

Gene: EF0815: Predicted galactosamine disaccharide-specific PTS, EIIB component (EC 2.7.1.69)
 
Enterococcus faecium DO

Gene: EfaeDRAFT_0626: Predicted galactosamine disaccharide-specific PTS, EIIB component (EC 2.7.1.69)
Predicted galactosamine disaccharide-specific PTS, EIIB component (EC 2.7.1.69)
gadW
 2
Enterococcus faecalis V583

Gene: EF0816: Predicted galactosamine disaccharide-specific PTS, EIIC component (EC 2.7.1.69)

Gene: EF1803: Predicted galactosamine disaccharide-specific PTS, EIIC component (EC 2.7.1.69)
 
Enterococcus faecium DO
Predicted galactosamine disaccharide-specific PTS, EIIC component (EC 2.7.1.69)
gadE
 2
Enterococcus faecalis V583

Gene: EF0817: Predicted galactosamine disaccharide-specific PTS, EIID component (EC 2.7.1.69)

Gene: EF1802: Predicted galactosamine disaccharide-specific PTS, EIID component (EC 2.7.1.69)
 
Enterococcus faecium DO
Predicted galactosamine disaccharide-specific PTS, EIID component (EC 2.7.1.69)
gadF
 
Enterococcus faecalis V583

Gene: EF1801: Predicted galactosamine disaccharide-specific PTS, EIIA component (EC 2.7.1.69)
 
Enterococcus faecium DO

Gene: EfaeDRAFT_0625: Predicted galactosamine disaccharide-specific PTS, EIIA component (EC 2.7.1.69)
Predicted galactosamine disaccharide-specific PTS, EIIA component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD