Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AgaR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylgalactosamine utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052 8 3
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521 16 4
Clostridium kluyveri DSM 555
Clostridium novyi NT 12 5
Clostridium perfringens ATCC 13124 3 2
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
agaA2
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -51
score = 5.95037
sequence = TAAGTGGTAATTACCAGTTG

Site:
position = -267
score = 5.76517
sequence = TAAGTGGTAATTACCAAATA

Gene: CBY_3029: N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
Cbei_4539
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -192
score = 4.81845
sequence = AAACTGGTAGTATCCAGTTA

Gene: Cbei_4539: Putative transcriptional regulator with PTS regulatory domain
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3358: Putative transcriptional regulator with PTS regulatory domain
 
Clostridium butyricum 5521

Gene: CBY_3030: Putative transcriptional regulator with PTS regulatory domain
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Putative transcriptional regulator with PTS regulatory domain
Cbei_4538
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4538: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3357: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Clostridium butyricum 5521

Gene: CBY_3031: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Cbei_4537
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4537: PTS system, lichenan-, cellobiose-specific IIA component (EC 2.7.1.69); PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3356: PTS system, lichenan-, cellobiose-specific IIA component (EC 2.7.1.69); PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Clostridium butyricum 5521

Gene: CBY_3032: PTS system, lichenan-, cellobiose-specific IIA component (EC 2.7.1.69); PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, lichenan-, cellobiose-specific IIA component (EC 2.7.1.69); PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
agaK
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4536: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3355: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
 
Clostridium butyricum 5521

Gene: CBY_3033: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
PF05913
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3354: Bacterial protein of unknown function (DUF871)
 
Clostridium butyricum 5521

Gene: CBY_3034: Bacterial protein of unknown function (DUF871)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Bacterial protein of unknown function (DUF871)
Cbei_4535
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4535: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO3359: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Clostridium butyricum 5521

Gene: CBY_3035: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
 
CRON 2.
NT01CX_0299
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -235
score = 5.27539
sequence = GAACTGGTAATGACAACATT

Site:
position = -317
score = 5.78865
sequence = AATGTGGTAATAACAACATT

Gene: NT01CX_0299: Predicted N-acetylgalactosamine permease
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Predicted N-acetylgalactosamine permease
NT01CX_0298
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0298: conserved hypothetical protein
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
conserved hypothetical protein
NT01CX_0297
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0297: N-acetylgalactosamine 6-sulfate sulfatase
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
N-acetylgalactosamine 6-sulfate sulfatase
agaK2
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3471: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0296: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
*
Clostridium perfringens ATCC 13124

Site:
position = -40
score = 5.78808
sequence = CAAGTGGTAATTACAACTAT

Gene: CPF_2149: Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
 
Clostridium tetani E88
Predicted N-acetylgalactosamine kinase (EC 2.7.1.157)
 
CRON 3.
Cbei_1383
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1383: Predicted N-acetylgalactosamine permease
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -76
score = 4.10729
sequence = CAACTTGTACGAACAAGTTG

Gene: NT01CX_0301: Predicted N-acetylgalactosamine permease
 
Clostridium perfringens ATCC 13124

Gene: CPF_0087: Predicted N-acetylgalactosamine permease
 
Clostridium tetani E88

Gene: CTC00514: Predicted N-acetylgalactosamine permease
Predicted N-acetylgalactosamine permease
NT01CX_0300
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0300: N-acetylglucosamine-6-sulfatase
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
N-acetylglucosamine-6-sulfatase
 
CRON 4.
CBY_3473
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -19
score = 4.65378
sequence = AAATTGGTTAATACCAAAAA

Gene: CBY_3473: PTS system, N-acetylgalactosamine- and galactosamine-specific IIB component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, N-acetylgalactosamine- and galactosamine-specific IIB component (EC 2.7.1.69)
CBY_3474
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3474: PTS system, N-acetylgalactosamine- and galactosamine-specific IIC component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, N-acetylgalactosamine- and galactosamine-specific IIC component (EC 2.7.1.69)
CBY_3475
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3475: PTS system, N-acetylgalactosamine- and galactosamine-specific IID component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, N-acetylgalactosamine- and galactosamine-specific IID component (EC 2.7.1.69)
agaR
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -171
score = 5.94456
sequence = TTAGTGGTAATTACCACTTG

Site:
position = -269
score = 5.14402
sequence = TAAGTGGACATTATCAGTTT

Gene: Cbei_4563: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
 
Clostridium botulinum A str. ATCC 3502
*2
Clostridium butyricum 5521

Site:
position = -201
score = 5.76517
sequence = TATTTGGTAATTACCACTTA

Gene: CBY_3028: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family

Gene: CBY_3476: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
 
Clostridium kluyveri DSM 555
*2
Clostridium novyi NT

Site:
position = -41
score = 4.8302
sequence = TAAGTGGTATGTACAACATG

Gene: NT01CX_0293: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family

Site:
position = -350
score = 4.10729
sequence = CAACTTGTTCGTACAAGTTG

Gene: NT01CX_0302: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
 
Clostridium perfringens ATCC 13124

Gene: CPF_2963: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
 
Clostridium tetani E88
Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
agaS
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_2904: Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3477: Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
 
Clostridium kluyveri DSM 555
*
Clostridium novyi NT

Site:
position = -53
score = 5.07942
sequence = TAACTGGTAATGACAACACA

Gene: NT01CX_0292: Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
*
Clostridium perfringens ATCC 13124

Site:
position = -38
score = 5.46221
sequence = CAACTGGTAATGACAACATT

Site:
position = -83
score = 4.96257
sequence = TAACTTGTAATAACATCATT

Gene: CPF_2961: Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
 
Clostridium tetani E88
Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
CBY_3478
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3478: PTS system, N-acetylgalactosamine- and galactosamine-specific IIA component (EC 2.7.1.69)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
PTS system, N-acetylgalactosamine- and galactosamine-specific IIA component (EC 2.7.1.69)
agaY
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2952: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1993: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 2
Clostridium butyricum 5521

Gene: CBY_3479: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)

Gene: CBY_2990: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0290: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2962: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
Clostridium tetani E88
Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
agaA
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -58
score = 5.14402
sequence = AAACTGATAATGTCCACTTA

Site:
position = -156
score = 5.94456
sequence = CAAGTGGTAATTACCACTAA

Gene: Cbei_4564: N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -285
score = 4.65378
sequence = TTTTTGGTATTAACCAATTT

Gene: CBY_3472: N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0291: N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2434: N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Clostridium tetani E88
N-acetylgalactosamine-6-phosphate deacetylase (EC 3.5.1.25)
agaZ
 
Clostridium acetobutylicum ATCC 824

Gene: CAC2951: Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1992: Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
 
Clostridium butyricum 5521

Gene: CBY_2991: Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0289: Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Tagatose-6-phosphate kinase (EC 2.7.1.144) / 1-phosphofructokinase (EC 2.7.1.56)
nagB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4562: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_0397: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_2744: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
 
Clostridium tetani E88

Gene: CTC02631: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD