Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AgaR - Clostridia-2

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: N-acetylgalactosamine utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium bartlettii DSM 16795
Clostridium difficile 630 5 3
Clostridium hiranonis DSM 13275
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
agaS
 
Clostridium bartlettii DSM 16795
*
Clostridium difficile 630

Site:
position = -246
score = 6.13651
sequence = TTAGTGGTAATTACCACTTT

Site:
position = -53
score = 5.09004
sequence = AAAGTGGGTATAACCTCATT

Gene: CD3449: Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
 
Clostridium hiranonis DSM 13275
Galactosamine-6-phosphate isomerase (EC 5.3.1.-)
agaY
 
Clostridium bartlettii DSM 16795
 
Clostridium difficile 630

Gene: CD3448: Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
Clostridium hiranonis DSM 13275
Tagatose 1,6-diphosphate aldolase (EC 4.1.2.40)
 
CRON 2.
agaR
 
Clostridium bartlettii DSM 16795
*
Clostridium difficile 630

Site:
position = -182
score = 5.93272
sequence = AAAGTGGTTATTACCAATTT

Site:
position = -37
score = 5.88023
sequence = ATTGTGGTAATAACCACTTA

Gene: CD3452: Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
 
Clostridium hiranonis DSM 13275
Transcriptional regulator of N-Acetylgalactosamine utilization, GntR family
agaA
 
Clostridium bartlettii DSM 16795
 
Clostridium difficile 630

Gene: CD3453: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Clostridium hiranonis DSM 13275
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
CRON 3.
agaZ
 
Clostridium bartlettii DSM 16795
*
Clostridium difficile 630

Site:
position = -106
score = 5.93272
sequence = AAATTGGTAATAACCACTTT

Site:
position = -251
score = 5.88023
sequence = TAAGTGGTTATTACCACAAT

Gene: CD3451: Tagatose-6-phosphate kinase (EC 2.7.1.144)
 
Clostridium hiranonis DSM 13275
Tagatose-6-phosphate kinase (EC 2.7.1.144)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD