Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FnrN/FixK/AadR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 192 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon) 51 16
Azorhizobium caulinodans ORS 571 18 5
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110 33 21
Bradyrhizobium sp. BTAi1 44 20
Brucella melitensis 16M 13 6
Mesorhizobium loti MAFF303099 18 6
Mesorhizobium sp. BNC1 28 7
Nitrobacter winogradskyi Nb-255 8 3
Rhizobium etli CFN 42 37 13
Rhizobium leguminosarum bv. viciae 3841 33 14
Rhizobium sp. NGR234 29 11
Rhodopseudomonas palustris CGA009 74 28
Sinorhizobium meliloti 1021 33 10
Xanthobacter autotrophicus Py2 14 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ccoN
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -131
score = 5.53442
sequence = TTCTTGATCTGGATCAAGGT

Gene: Atu1537: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Azorhizobium caulinodans ORS 571

Site:
position = -93
score = 4.99923
sequence = CCTTTGACTTGTATCAAGGT

Gene: AZC_4523: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -73
score = 4.78798
sequence = ATCTTGATTTCAATCAATTC

Gene: blr2763: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Bradyrhizobium sp. BTAi1

Site:
position = -100
score = 5.15966
sequence = AACTTGATTTCGATCAATTC

Gene: BBta_2792: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Brucella melitensis 16M

Site:
position = -108
score = 5.50733
sequence = TGTTTGATTTAGATCAATGA

Gene: BMEI1564: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*2
Mesorhizobium loti MAFF303099

Site:
position = -96
score = 5.53145
sequence = GCTTTGACCTGGATCAAGGC

Gene: mll6630: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Gene: mlr6411: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Mesorhizobium sp. BNC1

Site:
position = -90
score = 5.14974
sequence = GATTTGATCCAGAGCAAAGT

Gene: Meso_2250: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
 
Nitrobacter winogradskyi Nb-255
*2
Rhizobium etli CFN 42

Site:
position = -105
score = 5.21759
sequence = TTGTTGATGTAGATCAAGGA

Gene: RHE_PD00296: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Site:
position = -373
score = 5.21759
sequence = TTGTTGATGTAGATCAAGGA

Gene: RHE_PF00507: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*3
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -96
score = 5.21759
sequence = TTGTTGATGTAGATCAAGGA

Gene: pRL90018: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Site:
position = -96
score = 5.21151
sequence = TCGTTGACGCAGATCAAGGC

Gene: pRL100205: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Gene: RL0536: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*2
Rhizobium sp. NGR234

Site:
position = -115
score = 5.53987
sequence = ACCTTGATCTGAATCAAGGC

Gene: NGR_c17990: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Gene: NGR_c25810: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Rhodopseudomonas palustris CGA009

Site:
position = -79
score = 5.0962
sequence = ATTTTGATTTCGATCAAACG

Gene: RPA0019: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*3
Sinorhizobium meliloti 1021

Gene: SMa0765: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Gene: SMa0612: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)

Site:
position = -109
score = 5.72143
sequence = CACTTGATCTGGATCAAGGT

Gene: SMa1220: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
*
Xanthobacter autotrophicus Py2

Site:
position = -97
score = 5.16175
sequence = GCTTTGACCTGTATCAAGGA

Gene: Xaut_0459: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
ccoO
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1536: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4524: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2764: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2793: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Brucella melitensis 16M

Gene: BMEI1565: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 2
Mesorhizobium loti MAFF303099

Gene: mll6629: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: mlr6412: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_2251: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PD00295: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: RHE_PF00506: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 3
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90017: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: pRL100206: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: RL0535: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 2
Rhizobium sp. NGR234

Gene: NGR_c25800: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: NGR_c17980: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0018: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 3
Sinorhizobium meliloti 1021

Gene: SMa0615: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: SMa0766: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)

Gene: SMa1216: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0460: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
ccoQ
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1535: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4525: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bsr2765: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 2
Mesorhizobium loti MAFF303099

Gene: msl6627: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)

Gene: msr6413: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_2252: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PD00294: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)

Gene: RHE_PF00505: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 3
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90016A: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)

Gene: RL0533A: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)

Gene: pRL100206A: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Rhizobium sp. NGR234

Gene: NGR_c25790: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0017: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 3
Sinorhizobium meliloti 1021

Gene: SMa1214: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)

Gene: SMa0767: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)

Gene: SMa0616: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0461: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
ccoP
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1534: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4526: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2766: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2794: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Brucella melitensis 16M

Gene: BMEI1566: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 2
Mesorhizobium loti MAFF303099

Gene: mll6628: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: mlr6414: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_2253: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PF00504: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: RHE_PD00293: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 3
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90016: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: RL0534: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: pRL100207: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 2
Rhizobium sp. NGR234

Gene: NGR_c25780: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: NGR_c17970: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0016: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 3
Sinorhizobium meliloti 1021

Gene: SMa1213: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: SMa0769: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)

Gene: SMa0617: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0462: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
ccoG
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -72
score = 5.19607
sequence = CACTTGATGTAAGTCAAGGA

Gene: Atu1530: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4527: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -74
score = 5.25511
sequence = CGTTTGAGCTGGATCAACGG

Gene: blr2767: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Bradyrhizobium sp. BTAi1

Site:
position = -86
score = 5.109
sequence = CAATTGAGCTGGATCAACTG

Gene: BBta_2795: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Brucella melitensis 16M

Gene: BMEI1567: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*2
Mesorhizobium loti MAFF303099

Site:
position = -129
score = 5.1199
sequence = GGATTGACCTGCATCAACGC

Gene: mll6626: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation

Site:
position = -145
score = 4.80645
sequence = CGATTGACCTGCAGCAAGGC

Gene: mlr6415: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*2
Rhizobium etli CFN 42

Site:
position = -69
score = 5.32776
sequence = TTCTTGATCTGCATCAAGGA

Site:
position = -209
score = 5.16368
sequence = AGTTTGATCTGCCTCAAAGA

Gene: RHE_PD00292: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation

Site:
position = -70
score = 5.32776
sequence = TTCTTGATCTGCATCAAGGA

Gene: RHE_PF00503: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*2
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -241
score = 4.75942
sequence = AGTTTGACCGGTGTCAAGGA

Site:
position = -69
score = 5.32776
sequence = TTCTTGATCTGCATCAAGGA

Gene: pRL90015: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation

Site:
position = -69
score = 5.34136
sequence = CTCTTGATCTGCATCAAGGA

Site:
position = -218
score = 4.99856
sequence = AGTTTGACCTGCCTCAAAGA

Gene: pRL100208: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Rhizobium sp. NGR234

Site:
position = -79
score = 5.3209
sequence = GACTTGACGCAGATCAAGGT

Gene: NGR_c17930: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Rhodopseudomonas palustris CGA009

Gene: RPA0015: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
*
Sinorhizobium meliloti 1021

Site:
position = -82
score = 5.3209
sequence = GACTTGACGCAGATCAAGGT

Gene: SMa1211: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0463: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
ccoH
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1529: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4528: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2768: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2796: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Brucella melitensis 16M

Gene: BMEI1568: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 2
Mesorhizobium loti MAFF303099

Gene: mll6625: Type cbb3 cytochrome oxidase biogenesis protein CcoH

Gene: mlr6416: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PF00502: Type cbb3 cytochrome oxidase biogenesis protein CcoH

Gene: RHE_PD00291: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90014: Type cbb3 cytochrome oxidase biogenesis protein CcoH

Gene: pRL100209: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Rhizobium sp. NGR234

Gene: NGR_c17920: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Rhodopseudomonas palustris CGA009

Gene: RPA0014: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Sinorhizobium meliloti 1021

Gene: SMa1210: Type cbb3 cytochrome oxidase biogenesis protein CcoH
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0464: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Type cbb3 cytochrome oxidase biogenesis protein CcoH
ccoI
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1528: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4529: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2769: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2797: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Brucella melitensis 16M

Gene: BMEI1569: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 2
Mesorhizobium loti MAFF303099

Gene: mll6624: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: mlr6417: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Mesorhizobium sp. BNC1

Gene: Meso_2255: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PF00501: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: RHE_PD00290: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 3
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90013: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: RL0532: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: pRL100210: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 2
Rhizobium sp. NGR234

Gene: NGR_c25750: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: NGR_c17910: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0013: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 2
Sinorhizobium meliloti 1021

Gene: SMa0621: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: SMa1209: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0465: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoS
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1527: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4530: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: bsr2770: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2798: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Brucella melitensis 16M
 2
Mesorhizobium loti MAFF303099

Gene: msr6418: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Gene: msl6623: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Mesorhizobium sp. BNC1

Gene: Meso_2256: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PF00500: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Gene: RHE_PD00289: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100210A: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Gene: pRL90012A: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 2
Rhizobium sp. NGR234

Gene: NGR_c25740: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Gene: NGR_c17900: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Rhodopseudomonas palustris CGA009

Gene: RPA0012: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 2
Sinorhizobium meliloti 1021

Gene: SMa0622: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion

Gene: SMa1208: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0466: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
PF00083
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4531: Predicted transporter, MFS family
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0467: Predicted transporter, MFS family
Predicted transporter, MFS family
COG5473
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1

Gene: Meso_2254: Predicted integral membrane protein
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0533: Predicted integral membrane protein
 
Rhizobium sp. NGR234

Gene: NGR_c25760: Predicted integral membrane protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa0620: Predicted integral membrane protein
 
Xanthobacter autotrophicus Py2
Predicted integral membrane protein
pRL100211
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 2
Rhizobium etli CFN 42

Gene: RHE_PF00499: transcriptional regulator, Crp/Fnr family

Gene: RHE_PD00288: transcriptional regulator, Crp/Fnr family
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL100211: transcriptional regulator, Crp/Fnr family

Gene: pRL90012: transcriptional regulator, Crp/Fnr family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
transcriptional regulator, Crp/Fnr family
 
CRON 2.
paz
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -93
score = 4.03148
sequence = CATTTGATTTTTCGCAAAGA

Gene: Atu2283: pseudoazurin
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -92
score = 4.74314
sequence = TGTTTGACAGACATCAAAGA

Gene: NGR_c09980: pseudoazurin
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -92
score = 4.65215
sequence = TATTTGACAAGCATCAAAGA

Gene: SMa1243: pseudoazurin
 
Xanthobacter autotrophicus Py2
pseudoazurin
 
CRON 3.
nirK
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -96
score = 4.27494
sequence = AGTTTGTTCCATCTCAAATT

Gene: Atu4382: Copper-containing nitrite reductase (EC 1.7.2.1)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -77
score = 4.02179
sequence = AGCTTGTTGCAGCGCAAACA

Gene: blr7089: Copper-containing nitrite reductase (EC 1.7.2.1)
*
Bradyrhizobium sp. BTAi1

Site:
position = -84
score = 3.86077
sequence = TGCTTGTTGCAGCACAAACA

Gene: BBta_6826: Copper-containing nitrite reductase (EC 1.7.2.1)
*
Brucella melitensis 16M

Site:
position = -188
score = 3.70133
sequence = CCTTTGTCTTAACGCAAACA

Site:
position = -95
score = 4.63208
sequence = ATATTGATTGCGGTCAAGGA

Gene: BMEII0988: Copper-containing nitrite reductase (EC 1.7.2.1)
 
Mesorhizobium loti MAFF303099
*3
Mesorhizobium sp. BNC1

Site:
position = -176
score = 4.73703
sequence = ACTTTGATCCAGCGCAACGT

Site:
position = -83
score = 4.31592
sequence = TATTTGCGCCAGAGCAAAGA

Gene: Meso_2243: Copper-containing nitrite reductase (EC 1.7.2.1)

Site:
position = -87
score = 4.0274
sequence = CGTTTGCGCCAGCGCAAAGA

Gene: Meso_4273: Copper-containing nitrite reductase (EC 1.7.2.1)

Gene: Meso_4422: Copper-containing nitrite reductase (EC 1.7.2.1)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2648: Copper-containing nitrite reductase (EC 1.7.2.1)
*
Rhizobium etli CFN 42

Site:
position = -118
score = 3.65757
sequence = ACTTTGTGCCGGCACAAACA

Site:
position = -95
score = 4.498
sequence = AGTTTGCGCCACGTCAAAGA

Gene: RHE_PF00525: Copper-containing nitrite reductase (EC 1.7.2.1)
 
Rhizobium leguminosarum bv. viciae 3841
*2
Rhizobium sp. NGR234

Site:
position = -196
score = 3.63829
sequence = TCTTTGACAATTGGCAAAGA

Site:
position = -92
score = 4.45581
sequence = TATTTGTTCCACCTCAAAGA

Gene: NGR_c09950: Copper-containing nitrite reductase (EC 1.7.2.1)

Gene: NGR_b14380: Copper-containing nitrite reductase (EC 1.7.2.1)
*2
Rhodopseudomonas palustris CGA009

Site:
position = -85
score = 3.90231
sequence = AGCTTGTGCTGGGACAAACA

Gene: RPA4145: Copper-containing nitrite reductase (EC 1.7.2.1)

Gene: RPA3306: Copper-containing nitrite reductase (EC 1.7.2.1)
*
Sinorhizobium meliloti 1021

Site:
position = -192
score = 3.63829
sequence = TCTTTGACAATTGGCAAAGA

Site:
position = -91
score = 4.5021
sequence = TGTTTGTTCCACCTCAAAGA

Gene: SMa1250: Copper-containing nitrite reductase (EC 1.7.2.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3971: Copper-containing nitrite reductase (EC 1.7.2.1)
Copper-containing nitrite reductase (EC 1.7.2.1)
nirV
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4381: Nitrite reductase accessory protein NirV
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr7090: Nitrite reductase accessory protein NirV
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6827: Nitrite reductase accessory protein NirV
 
Brucella melitensis 16M

Gene: BMEII0987: Nitrite reductase accessory protein NirV
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1

Gene: Meso_4272: Nitrite reductase accessory protein NirV
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00526: Nitrite reductase accessory protein NirV
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c09960: Nitrite reductase accessory protein NirV
 
Rhodopseudomonas palustris CGA009

Gene: RPA4146: Nitrite reductase accessory protein NirV
 
Sinorhizobium meliloti 1021

Gene: SMa1247: Nitrite reductase accessory protein NirV
 
Xanthobacter autotrophicus Py2
Nitrite reductase accessory protein NirV
nnrR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -129
score = 4.26673
sequence = TAGTTGATTCATATCATTTG

Gene: Atu4380: Nitric oxide stress response transcriptional regulator NnrR, Crp family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0986: Nitric oxide stress response transcriptional regulator NnrR, Crp family
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00527: Nitric oxide stress response transcriptional regulator NnrR, Crp family
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c09970: Nitric oxide stress response transcriptional regulator NnrR, Crp family
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1245: Nitric oxide stress response transcriptional regulator NnrR, Crp family
 
Xanthobacter autotrophicus Py2
Nitric oxide stress response transcriptional regulator NnrR, Crp family
nnrU
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4392: NnrU family protein, required for expression of nitric oxide and nitrite reductases (Nir and Nor)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00528: NnrU family protein, required for expression of nitric oxide and nitrite reductases (Nir and Nor)
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c09820: NnrU family protein, required for expression of nitric oxide and nitrite reductases (Nir and Nor)
 
Rhodopseudomonas palustris CGA009

Gene: RPA1485: NnrU family protein, required for expression of nitric oxide and nitrite reductases (Nir and Nor)
 
Sinorhizobium meliloti 1021

Gene: SMa1283: NnrU family protein, required for expression of nitric oxide and nitrite reductases (Nir and Nor)
 
Xanthobacter autotrophicus Py2
NnrU family protein, required for expression of nitric oxide and nitrite reductases (Nir and Nor)
Atu8040
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -68
score = 4.28521
sequence = TCTTTGCGGTCGGTCAAAGA

Gene: Atu8040: Conserved hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2085: Conserved hypothetical protein
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -64
score = 4.65348
sequence = TCTTTGCGCTTGATCAAAGA

Gene: NGR_c09830: Conserved hypothetical protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA1452: Conserved hypothetical protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Conserved hypothetical protein
 
CRON 4.
sinR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -174
score = 5.18302
sequence = TGTTTGATCGAAATCAATTC

Gene: Atu2394: Biofilm formation transcriptional regulator SinR, Crp Family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -96
score = 4.89876
sequence = CCGTTGACCAAAATCAATTC

Gene: RL3726: Biofilm formation transcriptional regulator SinR, Crp Family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Biofilm formation transcriptional regulator SinR, Crp Family
 
CRON 5.
fixKf
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -152
score = 5.21759
sequence = TCCTTGATCTACATCAACAA

Gene: RHE_PF00508: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family
*3
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -121
score = 5.21759
sequence = TCCTTGATCTACATCAACAA

Gene: pRL90019: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family

Gene: RL1880: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family

Gene: pRL90025: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1141: Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family
 
Xanthobacter autotrophicus Py2
Nitrogen fixation and oxygen response transcriptional regulator FixKf, Crp family
fixLf
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_PF00509: Two-component oxygen-sensor histidine kinase FixLf
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90020: Two-component oxygen-sensor histidine kinase FixLf

Gene: RL1879: Two-component oxygen-sensor histidine kinase FixLf
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1142: Two-component oxygen-sensor histidine kinase FixLf
 
Xanthobacter autotrophicus Py2
Two-component oxygen-sensor histidine kinase FixLf
 
CRON 6.
fnrN
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -208
score = 3.99822
sequence = TATTTGCCTTTTATCAAGAA

Site:
position = -144
score = 4.8988
sequence = ACTTTGACTTCAATCAAATT

Gene: Atu1602: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
*
Brucella melitensis 16M

Site:
position = 19
score = 4.23
sequence = CATTAGATCAGAATCAAAAG

Gene: BMEI1294: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*2
Mesorhizobium loti MAFF303099

Site:
position = -103
score = 5.12119
sequence = GCCTTGATTTCGGTCAAAGC

Gene: mll6632: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

Site:
position = -102
score = 3.76169
sequence = GCCCTGATTTCGGTCAGCCT

Gene: mlr6409: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2061: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*2
Rhizobium etli CFN 42

Site:
position = -110
score = 5.47068
sequence = TCTTTGATCTGAATCAAATT

Site:
position = -79
score = 4.6197
sequence = CATTTGATAATCATCAAACT

Gene: RHE_CH02479: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family

Site:
position = -145
score = 5.57917
sequence = GATTTGATCTGGATCAAATC

Site:
position = -113
score = 4.55795
sequence = AAATTGATAGCCATCAAAGA

Gene: RHE_PD00216: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -135
score = 5.73779
sequence = GCTTTGATCTAGATCAAACA

Site:
position = -103
score = 4.23989
sequence = AAATTGATAATCCTCAAGCG

Gene: RL2818: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
*
Rhizobium sp. NGR234

Site:
position = -162
score = 5.4761
sequence = TTTTTGATCTGGATCAAGTG

Site:
position = -123
score = 3.74417
sequence = AAATTGACATTCGTCAGTTC

Gene: NGR_c18100: Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Nitrogen fixation and oxygen response transcriptional regulator FnrN, Crp family
 
CRON 7.
COG3181
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3350: Conserved hypothetical protein
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL120278: Conserved hypothetical protein
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = 3
score = 4.00494
sequence = AGCTTGATCCGACGCATTGT

Gene: RPA4694: Conserved hypothetical protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Conserved hypothetical protein
ligR
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2695: Transcriptional regulator LigR, LysR family
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA4695: Transcriptional regulator LigR, LysR family
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Transcriptional regulator LigR, LysR family
 
CRON 8.
cbbF
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1811: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2581: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 2
Bradyrhizobium sp. BTAi1

Gene: BBta_0445: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)

Gene: BBta_6401: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 
Brucella melitensis 16M

Gene: BMEII0422: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2694: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c06580: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
*
Rhodopseudomonas palustris CGA009

Site:
position = -221
score = 4.02199
sequence = CTTCTGATCTAAATCACGGC

Gene: RPA4645: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 
Sinorhizobium meliloti 1021

Gene: SMb20202: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
 2
Xanthobacter autotrophicus Py2

Gene: Xaut_3528: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)

Gene: Xaut_1915: Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
Fructose-1,6-bisphosphatase, type I (EC 3.1.3.11)
cbbP
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2582: Phosphoribulokinase (EC 2.7.1.19)
 2
Bradyrhizobium sp. BTAi1

Gene: BBta_0446: Phosphoribulokinase (EC 2.7.1.19)

Gene: BBta_6400: Phosphoribulokinase (EC 2.7.1.19)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2693: Phosphoribulokinase (EC 2.7.1.19)
 
Rhizobium etli CFN 42

Gene: RHE_CH01580: Phosphoribulokinase (EC 2.7.1.19)
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA4644: Phosphoribulokinase (EC 2.7.1.19)
 
Sinorhizobium meliloti 1021

Gene: SMb20201: Phosphoribulokinase (EC 2.7.1.19)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1914: Phosphoribulokinase (EC 2.7.1.19)
Phosphoribulokinase (EC 2.7.1.19)
cbbT
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2583: Transketolase (EC 2.2.1.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6399: Transketolase (EC 2.2.1.1)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA4643: Transketolase (EC 2.2.1.1)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Transketolase (EC 2.2.1.1)
cbbA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2584: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 2
Bradyrhizobium sp. BTAi1

Gene: BBta_6398: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)

Gene: BBta_0450: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Brucella melitensis 16M

Gene: BMEII0423: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2692: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c06590: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Rhodopseudomonas palustris CGA009

Gene: RPA4642: Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Fructose-bisphosphate aldolase class II (EC 4.1.2.13)
cbbM
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA4641: Ribulose bisphosphate carboxylase (EC 4.1.1.39)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Ribulose bisphosphate carboxylase (EC 4.1.1.39)
 
CRON 9.
bll2758
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -50
score = 4.96349
sequence = CGATTGAGCCAAGTCAAGGC

Site:
position = -3
score = 4.02689
sequence = AGCATGATCGAGGTCAGTTC

Gene: bll2758: Predicted transcriptional regulator, two-component, OmpR family
*
Bradyrhizobium sp. BTAi1

Site:
position = -84
score = 5.36889
sequence = GGATTGAGCTAGATCAAGCG

Gene: BBta_2787: Predicted transcriptional regulator, two-component, OmpR family
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -92
score = 4.83332
sequence = GGATTGAGACAGATCAATCC

Gene: RPA4249: Predicted transcriptional regulator, two-component, OmpR family
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Predicted transcriptional regulator, two-component, OmpR family
 
CRON 10.
pufB
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6433: Light-harvesting LHI, beta subunit
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -451
score = 4.61553
sequence = GATTTGAGCTAGAACAATGC

Gene: RPA1525: Light-harvesting LHI, beta subunit
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Light-harvesting LHI, beta subunit
pufA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6432: Light-harvesting LHI, alpha subunit
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1526: Light-harvesting LHI, alpha subunit
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Light-harvesting LHI, alpha subunit
 
CRON 11.
phyB1
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -119
score = 4.22309
sequence = CTCTTGATCTTGCGCAAAAC

Gene: RPA3015: Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B
phyB2
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA3016: Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B
rphyB
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA3017: Two-component system response regulator
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Two-component system response regulator
COG0642
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA3018: Hypothetical protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Hypothetical protein
 
CRON 12.
iorA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -100
score = 4.37596
sequence = CCGTTGACTTAGCGCAAATA

Site:
position = -173
score = 4.0173
sequence = GAATTGACTCAGCACAAAAG

Gene: RPA1224: Indolepyruvate oxidoreductase subunit IorA (EC 1.2.7.8)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Indolepyruvate oxidoreductase subunit IorA (EC 1.2.7.8)
iorB
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1225: Indolepyruvate oxidoreductase subunit IorB (EC 1.2.7.8) / Ferredoxin
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Indolepyruvate oxidoreductase subunit IorB (EC 1.2.7.8) / Ferredoxin
korA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1226: 2-oxoglutarate oxidoreductase, alpha subunit (EC 1.2.7.3)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
2-oxoglutarate oxidoreductase, alpha subunit (EC 1.2.7.3)
korB
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1227: 2-oxoglutarate oxidoreductase, beta subunit (EC 1.2.7.3)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
2-oxoglutarate oxidoreductase, beta subunit (EC 1.2.7.3)
korC
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1228: 2-oxoglutarate oxidoreductase, gamma subunit (EC 1.2.7.3)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
2-oxoglutarate oxidoreductase, gamma subunit (EC 1.2.7.3)
paaK
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1229: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
CRON 13.
osmY
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
*
Mesorhizobium sp. BNC1

Site:
position = -131
score = 4.67847
sequence = GCTTTGATGAGCATCAACAT

Site:
position = -94
score = 4.78131
sequence = GCGTTGACGCCGATCAACGC

Gene: Meso_2264: Osmotically inducible protein Y precursor
 
Nitrobacter winogradskyi Nb-255
*
Rhizobium etli CFN 42

Site:
position = -75
score = 5.18061
sequence = TGCTTGATGAAGATCAACGA

Gene: RHE_PD00022: Osmotically inducible protein Y precursor
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -75
score = 5.18061
sequence = TGCTTGATGAAGATCAACGA

Gene: RL1878: Osmotically inducible protein Y precursor
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Osmotically inducible protein Y precursor
adhA
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -93
score = 4.12591
sequence = GATTTGCGATGGGTCAATTC

Gene: Atu0626: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
*
Azorhizobium caulinodans ORS 571

Site:
position = -175
score = 5.32924
sequence = GCGTTGATCCGCATCAAGCA

Site:
position = -67
score = 5.50976
sequence = AGCTTGATGCGGATCAAGGT

Gene: AZC_0320: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -72
score = 4.90777
sequence = GGTTTGACTCCAATCAAGGG

Gene: bll5655: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
*
Bradyrhizobium sp. BTAi1

Site:
position = -70
score = 4.63902
sequence = CTTTTGATACCGATCAAGAC

Gene: BBta_5308: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
*2
Brucella melitensis 16M

Site:
position = -85
score = 4.59247
sequence = CTCTTGACGGAAATCAACGC

Gene: BMEI0925: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing

Site:
position = -145
score = 4.16217
sequence = GCATTGCGTCTAATCAAGGA

Gene: BMEI1746: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1

Gene: Meso_2263: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Nitrobacter winogradskyi Nb-255
*2
Rhizobium etli CFN 42

Site:
position = -147
score = 4.15002
sequence = GCTTTGGCCGGCGTCAAGCT

Gene: RHE_PC00106: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing

Gene: RHE_PC00105: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
*2
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -79
score = 4.1907
sequence = GCTTTGCGATGAATCAATGC

Gene: pRL90027: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing

Site:
position = -65
score = 5.24175
sequence = TGTTTGACCGGGATCAAGTC

Gene: RL1876: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
*3
Rhizobium sp. NGR234

Gene: NGR_c26770: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing

Site:
position = -21
score = 4.96776
sequence = ATCTTGATGGAGGTCAAGGG

Gene: NGR_c03790: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing

Gene: NGR_b11340: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -126
score = 4.90575
sequence = TCTTTGATGCCCGTCAAGGA

Gene: SMa1296: Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Xanthobacter autotrophicus Py2
Alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
CRON 14.
hemA
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -166
score = 4.99429
sequence = TTTTTGATGTGAATCAATTT

Gene: Atu2613: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Azorhizobium caulinodans ORS 571

Site:
position = -84
score = 4.67057
sequence = CACTTGATCGAGCGCAAGGG

Gene: AZC_0334: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -150
score = 5.43171
sequence = TCTTTGATCGGGATCAAGTT

Gene: bll1200: 5-aminolevulinate synthase (EC 2.3.1.37)
 2
Bradyrhizobium sp. BTAi1

Gene: BBta_6405: 5-aminolevulinate synthase (EC 2.3.1.37)

Gene: BBta_0861: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Brucella melitensis 16M

Gene: BMEI1604: 5-aminolevulinate synthase (EC 2.3.1.37)
 2
Mesorhizobium loti MAFF303099

Gene: mll6600: 5-aminolevulinate synthase (EC 2.3.1.37)

Gene: mll5695: 5-aminolevulinate synthase (EC 2.3.1.37)
 
Mesorhizobium sp. BNC1

Gene: Meso_0088: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Nitrobacter winogradskyi Nb-255

Site:
position = -141
score = 4.28405
sequence = CATTTGCGCCAGAGCAAATT

Gene: Nwi_0242: 5-aminolevulinate synthase (EC 2.3.1.37)
*2
Rhizobium etli CFN 42

Site:
position = -238
score = 4.73143
sequence = TCTTTGATCGAAAGCAATCC

Site:
position = -69
score = 5.05916
sequence = AACTTGACGGAGATCAAATA

Gene: RHE_PF00489: 5-aminolevulinate synthase (EC 2.3.1.37)

Gene: RHE_CH03846: 5-aminolevulinate synthase (EC 2.3.1.37)
*2
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -70
score = 5.33189
sequence = AACTTGATCAGGATCAATTA

Gene: pRL90008: 5-aminolevulinate synthase (EC 2.3.1.37)

Gene: RL4379: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Rhizobium sp. NGR234

Site:
position = -156
score = 5.15931
sequence = TGCTTGACTTCGATCAAAGT

Gene: NGR_c30700: 5-aminolevulinate synthase (EC 2.3.1.37)
*2
Rhodopseudomonas palustris CGA009

Gene: RPA1554: 5-aminolevulinate synthase (EC 2.3.1.37)

Site:
position = -169
score = 5.2279
sequence = GCATTGATCTTCATCAAGCC

Gene: RPA0854: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Sinorhizobium meliloti 1021

Site:
position = -291
score = 4.32315
sequence = TGCTTGACTTCGATCGATGT

Gene: SMc03104: 5-aminolevulinate synthase (EC 2.3.1.37)
*
Xanthobacter autotrophicus Py2

Site:
position = -108
score = 4.3899
sequence = CTCTTGATTGGTATCAATAC

Gene: Xaut_2126: 5-aminolevulinate synthase (EC 2.3.1.37)
5-aminolevulinate synthase (EC 2.3.1.37)
 
CRON 15.
ccmI
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -148
score = 5.21633
sequence = AGTTTGACGTAAATCAAGGT

Gene: Atu0973: Cytochrome c heme lyase subunit CcmI
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1132: Cytochrome c heme lyase subunit CcmI
 
Bartonella quintana str. Toulouse

Gene: BQ03930: Cytochrome c heme lyase subunit CcmI
 
Bradyrhizobium japonicum USDA 110

Gene: blr3125: Cytochrome c heme lyase subunit CcmI
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3071: Cytochrome c heme lyase subunit CcmI
 
Brucella melitensis 16M

Gene: BMEI1334: Cytochrome c heme lyase subunit CcmI
*
Mesorhizobium loti MAFF303099

Site:
position = -98
score = 5.19421
sequence = CGGTTGATGTCGATCAAGGA

Gene: mlr7688: Cytochrome c heme lyase subunit CcmI
 
Mesorhizobium sp. BNC1

Gene: Meso_0897: Cytochrome c heme lyase subunit CcmI
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1191: Cytochrome c heme lyase subunit CcmI
*2
Rhizobium etli CFN 42

Gene: RHE_CH01289: Cytochrome c heme lyase subunit CcmI

Site:
position = -70
score = 4.83155
sequence = AATTTGACCGGCGTCAATGT

Gene: RHE_PF00498: Cytochrome c heme lyase subunit CcmI
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1436: Cytochrome c heme lyase subunit CcmI
 
Rhizobium sp. NGR234

Gene: NGR_c07790: Cytochrome c heme lyase subunit CcmI
*
Rhodopseudomonas palustris CGA009

Site:
position = -157
score = 5.30543
sequence = CCTTTGATTCAAATCAAGTT

Gene: RPA1919: Cytochrome c heme lyase subunit CcmI
 
Sinorhizobium meliloti 1021

Gene: SMc02361: Cytochrome c heme lyase subunit CcmI
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1655: Cytochrome c heme lyase subunit CcmI
Cytochrome c heme lyase subunit CcmI
ccmE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0974: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1133: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Bartonella quintana str. Toulouse

Gene: BQ03940: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Bradyrhizobium japonicum USDA 110

Gene: blr3126: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3072: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Brucella melitensis 16M

Gene: BMEI1333: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Mesorhizobium loti MAFF303099

Gene: mlr7689: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Mesorhizobium sp. BNC1

Gene: Meso_0898: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1192: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 2
Rhizobium etli CFN 42

Gene: RHE_CH01290: Cytochrome c-type biogenesis protein CcmE, heme chaperone

Gene: RHE_PF00497: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1437: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Rhizobium sp. NGR234

Gene: NGR_c07800: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Rhodopseudomonas palustris CGA009

Gene: RPA1920: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Sinorhizobium meliloti 1021

Gene: SMc02362: Cytochrome c-type biogenesis protein CcmE, heme chaperone
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1656: Cytochrome c-type biogenesis protein CcmE, heme chaperone
Cytochrome c-type biogenesis protein CcmE, heme chaperone
ccmF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0975: Cytochrome c heme lyase subunit CcmF
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1134: Cytochrome c heme lyase subunit CcmF
 
Bartonella quintana str. Toulouse

Gene: BQ03950: Cytochrome c heme lyase subunit CcmF
 
Bradyrhizobium japonicum USDA 110

Gene: blr3127: Cytochrome c heme lyase subunit CcmF
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3073: Cytochrome c heme lyase subunit CcmF
 
Brucella melitensis 16M

Gene: BMEI1332: Cytochrome c heme lyase subunit CcmF
 
Mesorhizobium loti MAFF303099

Gene: mlr7690: Cytochrome c heme lyase subunit CcmF
 
Mesorhizobium sp. BNC1

Gene: Meso_0899: Cytochrome c heme lyase subunit CcmF
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1193: Cytochrome c heme lyase subunit CcmF
 2
Rhizobium etli CFN 42

Gene: RHE_PF00496: Cytochrome c heme lyase subunit CcmF

Gene: RHE_CH01291: Cytochrome c heme lyase subunit CcmF
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1438: Cytochrome c heme lyase subunit CcmF
 
Rhizobium sp. NGR234

Gene: NGR_c07810: Cytochrome c heme lyase subunit CcmF
 
Rhodopseudomonas palustris CGA009

Gene: RPA1921: Cytochrome c heme lyase subunit CcmF
 
Sinorhizobium meliloti 1021

Gene: SMc02363: Cytochrome c heme lyase subunit CcmF
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1657: Cytochrome c heme lyase subunit CcmF
Cytochrome c heme lyase subunit CcmF
ccmH
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0976: Cytochrome c heme lyase subunit CcmH
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1135: Cytochrome c heme lyase subunit CcmH
 
Bartonella quintana str. Toulouse

Gene: BQ03960: Cytochrome c heme lyase subunit CcmH
 
Bradyrhizobium japonicum USDA 110

Gene: blr3128: Cytochrome c heme lyase subunit CcmH
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3074: Cytochrome c heme lyase subunit CcmH
 
Brucella melitensis 16M

Gene: BMEI1331: Cytochrome c heme lyase subunit CcmH
 
Mesorhizobium loti MAFF303099

Gene: mlr7691: Cytochrome c heme lyase subunit CcmH
 
Mesorhizobium sp. BNC1

Gene: Meso_0900: Cytochrome c heme lyase subunit CcmH
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1194: Cytochrome c heme lyase subunit CcmH
 
Rhizobium etli CFN 42

Gene: RHE_CH01292: Cytochrome c heme lyase subunit CcmH
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1439: Cytochrome c heme lyase subunit CcmH
 
Rhizobium sp. NGR234

Gene: NGR_c07820: Cytochrome c heme lyase subunit CcmH
 
Rhodopseudomonas palustris CGA009

Gene: RPA1922: Cytochrome c heme lyase subunit CcmH
 
Sinorhizobium meliloti 1021

Gene: SMc02364: Cytochrome c heme lyase subunit CcmH
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1658: Cytochrome c heme lyase subunit CcmH
Cytochrome c heme lyase subunit CcmH
 
CRON 16.
hemN
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -105
score = 3.83095
sequence = ACTTTGCGCGAGCGCAAGGT

Gene: bll7086: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
*
Bradyrhizobium sp. BTAi1

Site:
position = -88
score = 4.74306
sequence = GCTTTGAGCAGGCTCAAGGC

Site:
position = -161
score = 4.10892
sequence = ACTTTGAGGAAGCGCAAAGT

Gene: BBta_6824: Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Coproporphyrinogen III oxidase, oxygen-independent (EC 1.3.99.22)
bsl7085
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
*
Mesorhizobium sp. BNC1

Site:
position = -166
score = 4.57799
sequence = ACATTGTCCTGAATCAAATC

Gene: Meso_2247: hypothetical protein
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
bsl7085; hypothetical protein
 
CRON 17.
nosR
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -134
score = 4.88302
sequence = AGCTTGATCCAGCGCAAACA

Gene: blr0314: Nitrous oxide reductase maturation protein NosR
*
Bradyrhizobium sp. BTAi1

Site:
position = -182
score = 4.73085
sequence = TGTTTGATCCAGCGCAACGT

Gene: BBta_6007: Nitrous oxide reductase maturation protein NosR
 
Brucella melitensis 16M

Gene: BMEII0975: Nitrous oxide reductase maturation protein NosR
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2060: Nitrous oxide reductase maturation protein NosR
*
Sinorhizobium meliloti 1021

Site:
position = -83
score = 4.68456
sequence = AAGTTGATCTGGCGCAAAGA

Gene: SMa1179: Nitrous oxide reductase maturation protein NosR
 
Xanthobacter autotrophicus Py2
Nitrous oxide reductase maturation protein NosR
nosZ
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0315: Nitrous-oxide reductase (EC 1.7.99.6)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6008: Nitrous-oxide reductase (EC 1.7.99.6)
 2
Brucella melitensis 16M

Gene: BMEII0973: Nitrous-oxide reductase (EC 1.7.99.6)

Gene: BMEII0974: Nitrous-oxide reductase (EC 1.7.99.6)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2061: Nitrous-oxide reductase (EC 1.7.99.6)
 
Sinorhizobium meliloti 1021

Gene: SMa1182: Nitrous-oxide reductase (EC 1.7.99.6)
 
Xanthobacter autotrophicus Py2
Nitrous-oxide reductase (EC 1.7.99.6)
nosD
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0316: Nitrous oxide reductase maturation protein NosD
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6009: Nitrous oxide reductase maturation protein NosD
 
Brucella melitensis 16M

Gene: BMEII0972: Nitrous oxide reductase maturation protein NosD
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2062: Nitrous oxide reductase maturation protein NosD
 
Sinorhizobium meliloti 1021

Gene: SMa1183: Nitrous oxide reductase maturation protein NosD
 
Xanthobacter autotrophicus Py2
Nitrous oxide reductase maturation protein NosD
nosF
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0317: Nitrous oxide reductase maturation protein NosF (ATPase)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6010: Nitrous oxide reductase maturation protein NosF (ATPase)
 
Brucella melitensis 16M

Gene: BMEII0971: Nitrous oxide reductase maturation protein NosF (ATPase)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2063: Nitrous oxide reductase maturation protein NosF (ATPase)
 
Sinorhizobium meliloti 1021

Gene: SMa1184: Nitrous oxide reductase maturation protein NosF (ATPase)
 
Xanthobacter autotrophicus Py2
Nitrous oxide reductase maturation protein NosF (ATPase)
nosY
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0318: Nitrous oxide reductase maturation transmembrane protein NosY
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6011: Nitrous oxide reductase maturation transmembrane protein NosY
 
Brucella melitensis 16M

Gene: BMEII0970: Nitrous oxide reductase maturation transmembrane protein NosY
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2064: Nitrous oxide reductase maturation transmembrane protein NosY
 
Sinorhizobium meliloti 1021

Gene: SMa1185: Nitrous oxide reductase maturation transmembrane protein NosY
 
Xanthobacter autotrophicus Py2
Nitrous oxide reductase maturation transmembrane protein NosY
nosL
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0319: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6012: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
 
Brucella melitensis 16M

Gene: BMEII0969: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2065: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
 
Sinorhizobium meliloti 1021

Gene: SMa1186: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
 
Xanthobacter autotrophicus Py2
Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
nosX
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0320: Nitrous oxide reductase maturation periplasmic protein NosX
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6013: Nitrous oxide reductase maturation periplasmic protein NosX
 2
Brucella melitensis 16M

Gene: BMEII0967: Nitrous oxide reductase maturation periplasmic protein NosX

Gene: BMEII0968: Nitrous oxide reductase maturation periplasmic protein NosX
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA2066: Nitrous oxide reductase maturation periplasmic protein NosX
 
Sinorhizobium meliloti 1021

Gene: SMa1188: Nitrous oxide reductase maturation periplasmic protein NosX
 
Xanthobacter autotrophicus Py2
Nitrous oxide reductase maturation periplasmic protein NosX
 
CRON 18.
cydR
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -92
score = 4.73977
sequence = ATTTTGACGCAGGTCAAAAA

Gene: Atu4088: Predicted transcriptional regulator, ArsR family
*
Azorhizobium caulinodans ORS 571

Site:
position = -55
score = 5.05792
sequence = AGGTTGCTCCAGATCAAACC

Gene: AZC_0581: Predicted transcriptional regulator, ArsR family
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0763: Predicted transcriptional regulator, ArsR family
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -75
score = 5.07282
sequence = GATTTGACCCAAGTCAAATT

Gene: pRL90275: Predicted transcriptional regulator, ArsR family
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Predicted transcriptional regulator, ArsR family
cydD
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4089: ATP-binding/permease protein CydD
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0582: ATP-binding/permease protein CydD
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0762: ATP-binding/permease protein CydD
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90276: ATP-binding/permease protein CydD
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ATP-binding/permease protein CydD
cydC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4090: ATP-binding/permease protein CydC
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0583: ATP-binding/permease protein CydC
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0761: ATP-binding/permease protein CydC
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90277: ATP-binding/permease protein CydC
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ATP-binding/permease protein CydC
cydA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4091: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0584: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0760: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90278: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4092: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0585: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0759: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL90279: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydX
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu8036: Cytochrome d ubiquinol oxidase subunit CydX (EC 1.10.3.-)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0586: Cytochrome d ubiquinol oxidase subunit CydX (EC 1.10.3.-)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M

Gene: BMEII0758: Cytochrome d ubiquinol oxidase subunit CydX (EC 1.10.3.-)
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Cytochrome d ubiquinol oxidase subunit CydX (EC 1.10.3.-)
 
CRON 19.
napE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4405: Periplasmic nitrate reductase component NapE
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -104
score = 5.48817
sequence = GGATTGATCCAGATCAACGC

Gene: bsr7036: Periplasmic nitrate reductase component NapE
*
Bradyrhizobium sp. BTAi1

Site:
position = -103
score = 5.19286
sequence = GCCTTGATCCACGTCAACGC

Gene: BBta_1864: Periplasmic nitrate reductase component NapE
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -130
score = 4.73977
sequence = TAATTGACGAAAATCAATTT

Gene: NGR_c09990: Periplasmic nitrate reductase component NapE
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -131
score = 4.73977
sequence = TAATTGACGGAAATCAATTT

Gene: SMa1241: Periplasmic nitrate reductase component NapE
 
Xanthobacter autotrophicus Py2
Periplasmic nitrate reductase component NapE
napF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4406: Periplasmic nitrate reductase, ferredoxin-type protein NapF
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c10000: Periplasmic nitrate reductase, ferredoxin-type protein NapF
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1240: Periplasmic nitrate reductase, ferredoxin-type protein NapF
 
Xanthobacter autotrophicus Py2
Periplasmic nitrate reductase, ferredoxin-type protein NapF
napD
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4407: Periplasmic nitrate reductase component NapD
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr7037: Periplasmic nitrate reductase component NapD
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1863: Periplasmic nitrate reductase component NapD
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c10010: Periplasmic nitrate reductase component NapD
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1239: Periplasmic nitrate reductase component NapD
 
Xanthobacter autotrophicus Py2
Periplasmic nitrate reductase component NapD
napA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4408: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr7038: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1862: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c10020: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1236: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
 
Xanthobacter autotrophicus Py2
Periplasmic nitrate reductase precursor (EC 1.7.99.4)
napB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4409: Nitrate reductase cytochrome c550-type subunit
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr7039: Nitrate reductase cytochrome c550-type subunit
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1861: Nitrate reductase cytochrome c550-type subunit
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c10030: Nitrate reductase cytochrome c550-type subunit
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1233: Nitrate reductase cytochrome c550-type subunit
 
Xanthobacter autotrophicus Py2
Nitrate reductase cytochrome c550-type subunit
napC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4410: Cytochrome c-type protein NapC
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr7040: Cytochrome c-type protein NapC
 
Bradyrhizobium sp. BTAi1

Gene: BBta_1860: Cytochrome c-type protein NapC
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c10040: Cytochrome c-type protein NapC
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMa1232: Cytochrome c-type protein NapC
 
Xanthobacter autotrophicus Py2
Cytochrome c-type protein NapC
 
CRON 20.
aadR
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -103
score = 5.30633
sequence = GAATTGATCTGGGTCAACCG

Gene: bll6061: Nitrogen fixation and oxygen response transcriptional regulator AadR, Crp family
*
Bradyrhizobium sp. BTAi1

Site:
position = -82
score = 5.24257
sequence = CATTTGATTTGAATCAATCG

Gene: BBta_5746: Nitrogen fixation and oxygen response transcriptional regulator AadR, Crp family
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -127
score = 5.20416
sequence = ACCTTGATCTGTGTCAAGCT

Gene: RPA4234: Nitrogen fixation and oxygen response transcriptional regulator AadR, Crp family
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Nitrogen fixation and oxygen response transcriptional regulator AadR, Crp family
 
CRON 21.
ompW
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -140
score = 4.90237
sequence = CATTTGATCCATCTCAATCG

Gene: Atu3191: Outer membrane protein W precursor
*
Azorhizobium caulinodans ORS 571

Site:
position = -61
score = 5.5272
sequence = GATTTGATCTAGGTCAAACT

Gene: AZC_3742: Outer membrane protein W precursor
 
Bartonella quintana str. Toulouse
*2
Bradyrhizobium japonicum USDA 110

Site:
position = -231
score = 4.75452
sequence = TATTTGATTGGTATCAAATC

Gene: bll1766: Outer membrane protein W precursor

Site:
position = -63
score = 4.95422
sequence = GATTTGATCGGCGTCAAATC

Gene: blr1311: Outer membrane protein W precursor
*
Bradyrhizobium sp. BTAi1

Site:
position = -108
score = 5.39489
sequence = CGATTGATCGAGATCAAATC

Gene: BBta_0946: Outer membrane protein W precursor
*
Brucella melitensis 16M

Site:
position = -108
score = 5.47891
sequence = TCTTTGATTTGGATCAATGG

Gene: BMEI0454: Outer membrane protein W precursor
 
Mesorhizobium loti MAFF303099

Gene: mll6127: Outer membrane protein W precursor
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium sp. NGR234

Site:
position = -100
score = 5.10821
sequence = CGGTTGATCTCGATCAATAT

Gene: NGR_a02570: Outer membrane protein W precursor
*
Rhodopseudomonas palustris CGA009

Site:
position = -98
score = 5.61143
sequence = CATTTGATCCAGATCAAATC

Gene: RPA4502: Outer membrane protein W precursor
 
Sinorhizobium meliloti 1021
*
Xanthobacter autotrophicus Py2

Site:
position = -87
score = 4.91189
sequence = AAATTGACATAAATCAAACT

Gene: Xaut_1968: Outer membrane protein W precursor
Outer membrane protein W precursor
 
CRON 22.
blr3521
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -76
score = 4.58898
sequence = GCCTTGATTTGGCTCATACG

Gene: blr3521: Lipocalin-related protein and Bos/Can/Equ allergen
 
Bradyrhizobium sp. BTAi1

Gene: BBta_3681: Lipocalin-related protein and Bos/Can/Equ allergen
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -107
score = 4.69361
sequence = CGGTTGCGCCAGATCAATGT

Gene: RPA4462: Lipocalin-related protein and Bos/Can/Equ allergen
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Lipocalin-related protein and Bos/Can/Equ allergen
 
CRON 23.
COG2524
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2762: Predicted transcriptional regulator, contains C-terminal CBS domains
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -161
score = 5.19753
sequence = GGTTTGACCTTGATCAATTC

Gene: RPA4241: Predicted transcriptional regulator, contains C-terminal CBS domains
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Predicted transcriptional regulator, contains C-terminal CBS domains
 
CRON 24.
bchE
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr0853: Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
*
Bradyrhizobium sp. BTAi1

Site:
position = -76
score = 5.28062
sequence = CGTTTGAGCCAGATCAATTT

Gene: BBta_6404: Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll4828: Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH00422: Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0441: Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -71
score = 4.99926
sequence = CGTTTGATCTGCGTCAACAA

Gene: RPA1668: Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Mg-protoporphyrin IX monomethyl ester oxidative cyclase (EC 1.14.13.81)
 
CRON 25.
irr
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0153: Iron-responsive regulator Irr, Fur family
 2
Azorhizobium caulinodans ORS 571

Gene: AZC_0367: Iron-responsive regulator Irr, Fur family

Gene: AZC_3445: Iron-responsive regulator Irr, Fur family
 
Bartonella quintana str. Toulouse

Gene: BQ01230: Iron-responsive regulator Irr, Fur family
 2
Bradyrhizobium japonicum USDA 110

Gene: bll0768: Iron-responsive regulator Irr, Fur family

Gene: blr1216: Iron-responsive regulator Irr, Fur family
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0071: Iron-responsive regulator Irr, Fur family
 2
Brucella melitensis 16M

Gene: BMEI1955: Iron-responsive regulator Irr, Fur family

Gene: BMEI1563: Iron-responsive regulator Irr, Fur family
 
Mesorhizobium loti MAFF303099

Gene: mlr5570: Iron-responsive regulator Irr, Fur family
 
Mesorhizobium sp. BNC1

Gene: Meso_3940: Iron-responsive regulator Irr, Fur family
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0035: Iron-responsive regulator Irr, Fur family
 
Rhizobium etli CFN 42

Gene: RHE_CH00106: Iron-responsive regulator Irr, Fur family
 2
Rhizobium leguminosarum bv. viciae 3841

Gene: RL0115: Iron-responsive regulator Irr, Fur family

Gene: pRL110146: Iron-responsive regulator Irr, Fur family
 
Rhizobium sp. NGR234

Gene: NGR_c35780: Iron-responsive regulator Irr, Fur family
*2
Rhodopseudomonas palustris CGA009

Site:
position = -70
score = 4.53116
sequence = GATTTGACTGCGGTCAATTC

Site:
position = -188
score = 5.29217
sequence = TCCTTGATGCACATCAAATG

Gene: RPA2339: Iron-responsive regulator Irr, Fur family

Gene: RPA0424: Iron-responsive regulator Irr, Fur family
 
Sinorhizobium meliloti 1021

Gene: SMc00329: Iron-responsive regulator Irr, Fur family
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3845: Iron-responsive regulator Irr, Fur family
Iron-responsive regulator Irr, Fur family
 
CRON 26.
hemC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2652: Porphobilinogen deaminase (EC 2.5.1.61)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0261: Porphobilinogen deaminase (EC 2.5.1.61)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr2398: Porphobilinogen deaminase (EC 2.5.1.61)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2191: Porphobilinogen deaminase (EC 2.5.1.61)
 
Brucella melitensis 16M

Gene: BMEI0176: Porphobilinogen deaminase (EC 2.5.1.61)
 
Mesorhizobium loti MAFF303099

Gene: mll4223: Porphobilinogen deaminase (EC 2.5.1.61)
 
Mesorhizobium sp. BNC1

Gene: Meso_3202: Porphobilinogen deaminase (EC 2.5.1.61)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0471: Porphobilinogen deaminase (EC 2.5.1.61)
 
Rhizobium etli CFN 42

Gene: RHE_CH03904: Porphobilinogen deaminase (EC 2.5.1.61)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4495: Porphobilinogen deaminase (EC 2.5.1.61)
 
Rhizobium sp. NGR234

Gene: NGR_c32110: Porphobilinogen deaminase (EC 2.5.1.61)
*
Rhodopseudomonas palustris CGA009

Site:
position = -243
score = 4.51042
sequence = CTTTTGACCTTGCTCAATAT

Site:
position = -143
score = 4.42536
sequence = GAATTGTCCGAGATCAACGA

Gene: RPA1505: Porphobilinogen deaminase (EC 2.5.1.61)
 
Sinorhizobium meliloti 1021

Gene: SMc03231: Porphobilinogen deaminase (EC 2.5.1.61)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1158: Porphobilinogen deaminase (EC 2.5.1.61)
Porphobilinogen deaminase (EC 2.5.1.61)
bchI
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6449: Protoporphyrin IX Mg-chelatase subunit I (EC 6.6.1.1)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1506: Protoporphyrin IX Mg-chelatase subunit I (EC 6.6.1.1)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Protoporphyrin IX Mg-chelatase subunit I (EC 6.6.1.1)
bchD
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6448: Protoporphyrin IX Mg-chelatase subunit D (EC 6.6.1.1)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1507: Protoporphyrin IX Mg-chelatase subunit D (EC 6.6.1.1)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Protoporphyrin IX Mg-chelatase subunit D (EC 6.6.1.1)
 
CRON 27.
RPA1090
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -133
score = 4.69551
sequence = CCATTGACATAGCTCAACCG

Gene: BBta_3690: Predicted transcriptional regulator, Crp family
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -72
score = 5.20713
sequence = CGGTTGATCAAGATCAACTG

Gene: RPA1090: Predicted transcriptional regulator, Crp family
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Predicted transcriptional regulator, Crp family
 
CRON 28.
mhpA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -52
score = 5.75838
sequence = CCTTTGATCCAGATCAAGCG

Gene: BBta_2733: Protocatechuate 4,5-dioxygenase alpha chain (EC 1.13.11.8)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -69
score = 4.87993
sequence = TATTTGACGCACGTCAAATA

Gene: RPA1006: Protocatechuate 4,5-dioxygenase alpha chain (EC 1.13.11.8)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Protocatechuate 4,5-dioxygenase alpha chain (EC 1.13.11.8)
mhpB
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2734: Protocatechuate 4,5-dioxygenase beta chain (EC 1.13.11.8)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA1007: Protocatechuate 4,5-dioxygenase beta chain (EC 1.13.11.8)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Protocatechuate 4,5-dioxygenase beta chain (EC 1.13.11.8)
 
CRON 29.
mtrA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -234
score = 5.35366
sequence = TAATTGATCTCGATCAAATA

Gene: RPA0746: Decaheme cytochrome c MtrA
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Decaheme cytochrome c MtrA
 
CRON 30.
badD
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -120
score = 5.37562
sequence = AATTTGATCCGCATCAAATT

Gene: RPA0657: Benzoyl-CoA reductase subunit BadD (EC 1.3.99.15)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Benzoyl-CoA reductase subunit BadD (EC 1.3.99.15)
badE
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0658: Benzoyl-CoA reductase subunit BadE (EC 1.3.99.15)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Benzoyl-CoA reductase subunit BadE (EC 1.3.99.15)
badF
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0659: Benzoyl-CoA reductase subunit BadF (EC 1.3.99.15)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Benzoyl-CoA reductase subunit BadF (EC 1.3.99.15)
badG
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0660: Benzoyl-CoA reductase subunit BadG (EC 1.3.99.15)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Benzoyl-CoA reductase subunit BadG (EC 1.3.99.15)
badA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6637: Benzoate-CoA ligase (EC 6.2.1.25)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0661: Benzoate-CoA ligase (EC 6.2.1.25)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Benzoate-CoA ligase (EC 6.2.1.25)
 
CRON 31.
RPA0260
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = 13
score = 4.97283
sequence = GTTTTGATCCAGAGCAAAGA

Gene: RPA0260: Possible photosynthesis gene regulator, AppA/PpaA family
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Possible photosynthesis gene regulator, AppA/PpaA family
 
CRON 32.
bsr3073
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -41
score = 4.51609
sequence = GATTTGTCCGGGATCAATGA

Site:
position = -104
score = 5.1644
sequence = TCATTGACGCGGATCAATTG

Gene: bsr3073: Conserved hypothetical protein
*
Bradyrhizobium sp. BTAi1

Site:
position = -90
score = 4.881
sequence = CGGTTGTTCCAGATCAATGA

Gene: BBta_3726: Conserved hypothetical protein
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -58
score = 5.72616
sequence = CGTTTGATCCAGATCAAACT

Gene: RPA1014: Conserved hypothetical protein
 
Sinorhizobium meliloti 1021
*
Xanthobacter autotrophicus Py2

Site:
position = -72
score = 4.31271
sequence = CAGTTGATCGTTGTCAAAAG

Gene: Xaut_3275: Conserved hypothetical protein
Conserved hypothetical protein
 
CRON 33.
ctaC
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -178
score = 4.15737
sequence = GGATTGATCAATGGCAAAAT

Site:
position = -71
score = 5.09475
sequence = TGATTGATCTAGATCAGACG

Gene: Atu0767: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2960: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -181
score = 4.24938
sequence = GCATTGCGATAGATCAAGAA

Gene: BBta_0828: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Brucella melitensis 16M

Gene: BMEI1466: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Mesorhizobium loti MAFF303099

Gene: mlr7490: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_0741: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*2
Nitrobacter winogradskyi Nb-255

Site:
position = -196
score = 4.47443
sequence = TGTTTGATACAGCGCAAAGA

Gene: Nwi_0761: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)

Gene: Nwi_0223: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Rhizobium etli CFN 42

Site:
position = -177
score = 4.10268
sequence = CGTTTGAGCCAACACAATGC

Gene: RHE_CH00952: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1021: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Rhizobium sp. NGR234

Site:
position = -38
score = 5.46676
sequence = GGTTTGATCCTGATCAAGCG

Gene: NGR_c05230: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0831: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
*
Sinorhizobium meliloti 1021

Site:
position = -38
score = 5.46676
sequence = GGTTTGATCCTGATCAAGCG

Gene: SMc00009: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4648: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
ctaD
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0768: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2959: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0829: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Brucella melitensis 16M

Gene: BMEI1465: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Mesorhizobium loti MAFF303099

Gene: mlr7491: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_0742: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 2
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0762: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)

Gene: Nwi_0224: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00953: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1022: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Rhizobium sp. NGR234

Gene: NGR_c05240: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0832: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Sinorhizobium meliloti 1021

Gene: SMc00010: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4647: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
ctaB
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -209
score = 3.84627
sequence = GCCTTTATGAAAAGCAAGCG

Gene: Atu0769: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2958: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0830: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Brucella melitensis 16M

Gene: BMEI1464: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Mesorhizobium loti MAFF303099

Gene: mlr7493: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Mesorhizobium sp. BNC1

Gene: Meso_0743: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 2
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0763: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB

Gene: Nwi_0225: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Rhizobium etli CFN 42

Gene: RHE_CH00954: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1023: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Rhizobium sp. NGR234

Gene: NGR_c05250: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Rhodopseudomonas palustris CGA009

Gene: RPA0833: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Sinorhizobium meliloti 1021

Gene: SMc00450: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4646: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
ctaX
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu8013: Hypothetical protein in cta gene cluster
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2957: Hypothetical protein in cta gene cluster
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0831: Hypothetical protein in cta gene cluster
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: msr7494: Hypothetical protein in cta gene cluster
 
Mesorhizobium sp. BNC1

Gene: Meso_0744: Hypothetical protein in cta gene cluster
 2
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0764: Hypothetical protein in cta gene cluster

Gene: Nwi_0226: Hypothetical protein in cta gene cluster
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1024: Hypothetical protein in cta gene cluster
 
Rhizobium sp. NGR234

Gene: NGR_c05260: Hypothetical protein in cta gene cluster
 
Rhodopseudomonas palustris CGA009

Gene: RPA0834: Hypothetical protein in cta gene cluster
 
Sinorhizobium meliloti 1021

Gene: SMc00130: Hypothetical protein in cta gene cluster
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4645: Hypothetical protein in cta gene cluster
Hypothetical protein in cta gene cluster
ctaG
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0770: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2956: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0832: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Brucella melitensis 16M

Gene: BMEI1463: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Mesorhizobium loti MAFF303099

Gene: mlr7495: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Mesorhizobium sp. BNC1

Gene: Meso_0745: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 2
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0765: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1

Gene: Nwi_0227: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Rhizobium etli CFN 42

Gene: RHE_CH00955: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1025: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Rhizobium sp. NGR234

Gene: NGR_c05270: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Rhodopseudomonas palustris CGA009

Gene: RPA0835: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Sinorhizobium meliloti 1021

Gene: SMc00012: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4644: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
ctaE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu0771: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2955: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0833: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Brucella melitensis 16M

Gene: BMEI1462: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Mesorhizobium loti MAFF303099

Gene: mlr7496: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_0746: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 2
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0766: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)

Gene: Nwi_0228: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH00956: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1026: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Rhizobium sp. NGR234

Gene: NGR_c05280: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA0836: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Sinorhizobium meliloti 1021

Gene: SMc00013: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4643: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
 
CRON 34.
hbaB
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -65
score = 4.41967
sequence = TGCTTGACTTTGGTCATGGA

Gene: RPA0670: 4-hydroxybenzoyl-CoA reductase, gamma subunit (EC 1.3.99.20)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
4-hydroxybenzoyl-CoA reductase, gamma subunit (EC 1.3.99.20)
hbaC
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0671: 4-hydroxybenzoyl-CoA reductase, alpha subunit (EC 1.3.99.20)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
4-hydroxybenzoyl-CoA reductase, alpha subunit (EC 1.3.99.20)
hbaD
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0672: 4-hydroxybenzoyl-CoA reductase, beta subunit (EC 1.3.99.20)
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
4-hydroxybenzoyl-CoA reductase, beta subunit (EC 1.3.99.20)
 
CRON 35.
blr6062
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -75
score = 5.30633
sequence = CGGTTGACCCAGATCAATTC

Gene: blr6062: Putative cytochrome C6 precursor
*
Bradyrhizobium sp. BTAi1

Site:
position = -77
score = 5.24257
sequence = CGATTGATTCAAATCAAATG

Gene: BBta_5747: Putative cytochrome C6 precursor
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
*
Nitrobacter winogradskyi Nb-255

Site:
position = -139
score = 5.27678
sequence = CGATTGATCCAAATCAAGAT

Site:
position = -77
score = 5.09598
sequence = GCCTTGACCTAAGTCAACGA

Gene: Nwi_1034: Putative cytochrome C6 precursor
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -21
score = 5.20416
sequence = AGCTTGACACAGATCAAGGT

Gene: RPA4235: Putative cytochrome C6 precursor
 
Sinorhizobium meliloti 1021

Gene: SMa1104: Putative cytochrome C6 precursor
 
Xanthobacter autotrophicus Py2
Putative cytochrome C6 precursor
 
CRON 36.
attK
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -123
score = 4.77614
sequence = CGATTGACCTGTCTCAAAGT

Gene: bll3998: Succinate-semialdehyde dehydrogenase [NAD] (EC 1.2.1.24); Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Succinate-semialdehyde dehydrogenase [NAD] (EC 1.2.1.24); Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
 
CRON 37.
hspC2
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*2
Bradyrhizobium japonicum USDA 110

Site:
position = -89
score = 4.90838
sequence = GGCTTGAGCAAAATCAAATT

Gene: blr4637: Small heat shock protein

Site:
position = -85
score = 4.75336
sequence = AATTTGAGACAAATCAAGGA

Gene: blr7961: Small heat shock protein
*
Bradyrhizobium sp. BTAi1

Site:
position = -153
score = 5.16036
sequence = CATTTGATCGTGATCAATCT

Gene: BBta_3527: Small heat shock protein
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
*
Mesorhizobium sp. BNC1

Site:
position = -256
score = 4.72749
sequence = AAGTTGACGCACGTCAATGC

Gene: Meso_2276: Small heat shock protein
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -87
score = 4.65473
sequence = GCCTTGTCCCAGGTCAATCC

Site:
position = -31
score = 4.80987
sequence = GATTTGACGGTGATCAAAGA

Gene: RL1883: Small heat shock protein
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
*
Sinorhizobium meliloti 1021

Site:
position = -172
score = 4.87352
sequence = TCTTTGACGCCGGTCAATGA

Gene: SMa1118: Small heat shock protein
 
Xanthobacter autotrophicus Py2
Small heat shock protein
 
CRON 38.
ppsA
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -50
score = 4.86392
sequence = AGGTTGACCTGCCTCAAGGC

Gene: blr4655: Phosphoenolpyruvate synthase (EC 2.7.9.2)
*
Bradyrhizobium sp. BTAi1

Site:
position = -76
score = 4.43248
sequence = CGCTTGATCTTCCGCAAGTC

Gene: BBta_6481: Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Phosphoenolpyruvate synthase (EC 2.7.9.2)
 
CRON 39.
adhP
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -81
score = 4.73571
sequence = GCATTGAGGGAGGTCAAGGA

Gene: blr6070: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
*
Bradyrhizobium sp. BTAi1

Site:
position = -75
score = 4.76686
sequence = ACCTTGACAGACATCAAGCC

Gene: BBta_5755: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0374: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
 
Sinorhizobium meliloti 1021
*2
Xanthobacter autotrophicus Py2

Site:
position = -107
score = 5.10745
sequence = CGGTTGACCCGCATCAATGC

Gene: Xaut_0669: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing

Gene: Xaut_2010: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
COG2187
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1165: Predicted kinase
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr6071: Predicted kinase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5756: Predicted kinase
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099

Gene: mll6593: Predicted kinase
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -60
score = 4.97797
sequence = TCATTGATGCGCGTCAATGC

Gene: pRL90039: Predicted kinase
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -149
score = 5.19753
sequence = GAATTGATCAAGGTCAAACC

Gene: RPA4242: Predicted kinase
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2

Gene: Xaut_0668: Predicted kinase
Predicted kinase
 
CRON 40.
BBta_5758
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -109
score = 5.27933
sequence = GAATTGACCCAGGTCAAAGG

Site:
position = -75
score = 5.11281
sequence = TCATTGATGCAGCTCAAGGC

Gene: BBta_5758: hypothetical protein
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
hypothetical protein
phbC
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
*
Bradyrhizobium japonicum USDA 110

Site:
position = -149
score = 5.19493
sequence = GGTTTGACTCAGGTCAAGCG

Site:
position = -84
score = 4.71877
sequence = GATTTGATGCAGCTCAACAC

Gene: bll6073: Polyhydroxyalkanoic acid synthase
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5757: Polyhydroxyalkanoic acid synthase
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -235
score = 5.01737
sequence = GGCTTGAGCAAGGTCAAGCG

Gene: RPA4243: Polyhydroxyalkanoic acid synthase
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Polyhydroxyalkanoic acid synthase
 
CRON 41.
nuoA
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -164
score = 4.05902
sequence = ATATTGTTGCCAATCAATGC

Gene: Atu1268: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1667: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05640: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4919: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4563: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1158: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1372: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
*
Mesorhizobium sp. BNC1

Site:
position = -136
score = 4.11689
sequence = GGTTTGACTTGCGTCACCGA

Gene: Meso_1022: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1888: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01602: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1700: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10480: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
*2
Rhodopseudomonas palustris CGA009

Site:
position = -130
score = 4.96028
sequence = GAGTTGATCCGCGTCAACCA

Gene: RPA4264: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)

Gene: RPA2952: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01912: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4633: NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
NADH ubiquinone oxidoreductase chain A (EC 1.6.5.3)
nuoB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1269: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1668: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05650: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4918: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4562: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1157: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1371: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1023: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1887: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01603: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1701: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10490: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA4263: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)

Gene: RPA2951: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01913: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4632: NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain B (EC 1.6.5.3)
nuoC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1270: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1669: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05660: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4917: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4561: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1156: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1369: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1024: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1886: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01604: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1702: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10500: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Rhodopseudomonas palustris CGA009

Gene: RPA2950: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01914: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4631: NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain C (EC 1.6.5.3)
PF04828
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1271: Hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Hypothetical protein
nouD
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1272: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1670: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05670: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4916: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4560: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1155: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1367: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1025: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1885: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01606: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1703: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10510: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA4262: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)

Gene: RPA2949: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01915: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4630: NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain D (EC 1.6.5.3)
Atu1273
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1273: Conserved hypothetical protein
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42

Gene: RHE_CH01607: Conserved hypothetical protein
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c10520: Conserved hypothetical protein
 
Rhodopseudomonas palustris CGA009
 
Sinorhizobium meliloti 1021

Gene: SMc01916: Conserved hypothetical protein
 
Xanthobacter autotrophicus Py2
Conserved hypothetical protein
nuoE
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1274: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1671: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05680: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4914: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4558: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1154: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1366: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1026: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1883: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01608: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1704: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10530: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2947: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)

Gene: RPA4261: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01917: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4629: NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain E (EC 1.6.5.3)
nuoF
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1275: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1672: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05690: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4912: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4556: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1153: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1365: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1027: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1882: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01609: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1705: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10540: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2945: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)

Gene: RPA4260: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01918: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4628: NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain F (EC 1.6.5.3)
nuoG
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1276: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1674: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05700: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4911: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4555: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1152: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1362: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1028: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1881: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01611: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1707: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10560: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA4259: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)

Gene: RPA2944: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01920: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4627: NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain G (EC 1.6.5.3)
nuoH
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1277: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1675: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05710: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4910: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4554: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1151: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1361: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1029: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1880: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01612: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1708: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10570: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA4258: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)

Gene: RPA2943: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01921: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4626: NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain H (EC 1.6.5.3)
nuoI
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1278: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1676: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05720: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4909: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4553: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1150: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1359: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1030: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1879: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01613: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1709: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10580: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA4257: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)

Gene: RPA2942: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01922: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4625: NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
nuoJ
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1279: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1677: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05730: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4908: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4552: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1149: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1358: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1031: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1878: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01614: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1710: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10590: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2941: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)

Gene: RPA4256: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01923: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4624: NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain J (EC 1.6.5.3)
nuoK
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1280: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1678: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05740: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4907: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4551: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1148: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1357: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1032: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1877: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01615: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1711: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10600: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2940: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)

Gene: RPA4255: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01924: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4623: NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain K (EC 1.6.5.3)
nuoL
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1281: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1679: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05750: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4906: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4550: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1147: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1355: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1033: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1876: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01616: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1712: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10610: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2939: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)

Gene: RPA4254: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01925: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4622: NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain L (EC 1.6.5.3)
nuoM
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1282: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1680: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05760: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4905: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4549: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1146: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1354: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1034: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1875: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01617: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1713: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10620: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2938: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)

Gene: RPA4253: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01926: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4621: NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain M (EC 1.6.5.3)
nuoN
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu1283: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1681: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Bartonella quintana str. Toulouse

Gene: BQ05770: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Bradyrhizobium japonicum USDA 110

Gene: bll4904: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4548: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Brucella melitensis 16M

Gene: BMEI1145: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Mesorhizobium loti MAFF303099

Gene: mll1352: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Mesorhizobium sp. BNC1

Gene: Meso_1035: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_1874: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Rhizobium etli CFN 42

Gene: RHE_CH01618: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL1714: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Rhizobium sp. NGR234

Gene: NGR_c10630: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 2
Rhodopseudomonas palustris CGA009

Gene: RPA2937: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)

Gene: RPA4252: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Sinorhizobium meliloti 1021

Gene: SMc01927: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_4620: NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
NADH-ubiquinone oxidoreductase chain N (EC 1.6.5.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD