Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IdeR - Clostridia-3

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Iron ion, (Fe2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 78 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Blautia hansenii DSM 20583 6 2
Bacteroides pectinophilus ATCC 43243 8 3
Bryantella formatexigens DSM 14469 13 5
Clostridiales bacterium 1_7_47_FAA 17 8
Clostridium bolteae ATCC BAA-613 14 7
Clostridium nexile DSM 1787 15 5
Clostridium scindens ATCC 35704 10 5
Ruminococcus lactaris ATCC 29176 12 4
Ruminococcus gnavus ATCC 29149 14 5
Roseburia intestinalis L1-82 8 4
Eubacterium rectale ATCC 33656 9 5
Eubacterium eligens ATCC 27750 11 4
Dorea longicatena DSM 13814 12 4
Dorea formicigenerans ATCC 27755 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG0426
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -105
score = 4.76479
sequence = TGAGTAAGTGTACACTAAATAA

Gene: Cbac1_010100025382: flavodoxin
*
Clostridium bolteae ATCC BAA-613

Site:
position = -107
score = 5.43755
sequence = ATTATTAGTGTACACTAATTTA

Gene: CLOBOL_00460: flavodoxin
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
flavodoxin
 
CRON 2.
RUMGNA_02766
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
*
Ruminococcus gnavus ATCC 29149

Site:
position = -93
score = 5.68954
sequence = ATGATTAGAATAAACTAATAAA

Site:
position = -36
score = 5.37837
sequence = ATAGTTAGCGAAAACTAACTTG

Gene: RUMGNA_02766: hypothetical protein
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
BRYFOR_03360
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02767: hypothetical protein
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
PF05031
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
*
Clostridium nexile DSM 1787

Site:
position = -63
score = 5.07371
sequence = CTGGTTAGTTTAATCTAACAAA

Gene: CLONEX_02589: Iron transport-associated domain
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
*
Ruminococcus gnavus ATCC 29149

Site:
position = -130
score = 4.33286
sequence = ATAAGTAGAATCTTCTAAAACA

Gene: RUMGNA_02768: Iron transport-associated domain
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
Iron transport-associated domain
PF11545
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_02590: Cell surface heme-binding protein Shp
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02769: Cell surface heme-binding protein Shp
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
Cell surface heme-binding protein Shp
COG0614
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_02591: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02770: ABC-type Fe3+-hydroxamate transport system, periplasmic component
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
ABC-type Fe3+-hydroxamate transport system, periplasmic component
COG0609
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_02592: ABC-type Fe3+-siderophore transport system, permease component
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
*
Ruminococcus gnavus ATCC 29149

Site:
position = -135
score = 4.29404
sequence = AACGATAAAGTGTACTATCTTA

Gene: RUMGNA_02771: ABC-type Fe3+-siderophore transport system, permease component
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
ABC-type Fe3+-siderophore transport system, permease component
COG1120
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_02593: ABC-type Fe3+-siderophores transport systems, ATPase components
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_02772: ABC-type Fe3+-siderophores transport systems, ATPase components
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
ABC-type Fe3+-siderophores transport systems, ATPase components
 
CRON 3.
COG1132
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
*
Bryantella formatexigens DSM 14469

Site:
position = -52
score = 4.96725
sequence = GGAGTTAGAAAATACTAACCCC

Gene: BRYFOR_00595: ABC-type multidrug transport system, ATPase and permease components
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -70
score = 4.47498
sequence = TTCGTTATAATACACTACAGTT

Site:
position = -54
score = 5.70479
sequence = ACAGTTAGTAAAATCTAACTAT

Gene: Cbac1_010100028374: ABC-type multidrug transport system, ATPase and permease components
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_00480: ABC-type multidrug transport system, ATPase and permease components
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00932: ABC-type multidrug transport system, ATPase and permease components
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
*
Dorea formicigenerans ATCC 27755

Site:
position = -55
score = 4.76543
sequence = GTGGTTAGATTAAGCTAACCCA

Gene: DORFOR_03080: ABC-type multidrug transport system, ATPase and permease components
ABC-type multidrug transport system, ATPase and permease components
COG1132-2
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00594: ABC-type multidrug transport system, ATPase and permease components
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100028379: ABC-type multidrug transport system, ATPase and permease components
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_00479: ABC-type multidrug transport system, ATPase and permease components
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00931: ABC-type multidrug transport system, ATPase and permease components
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_03079: ABC-type multidrug transport system, ATPase and permease components
ABC-type multidrug transport system, ATPase and permease components
 
CRON 4.
ideR
 
Blautia hansenii DSM 20583

Gene: BLAHAN_01115: Predicted iron-dependent repressor, DtxR family
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -135
score = 4.52534
sequence = ATGATTAAATTATGCTAAACAA

Gene: BACPEC_02631: Predicted iron-dependent repressor, DtxR family
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_03605: Predicted iron-dependent repressor, DtxR family
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -140
score = 4.54841
sequence = ATGGTTAGTTATTTCTAACTTC

Gene: Cbac1_010100022172: Predicted iron-dependent repressor, DtxR family
*3
Clostridium bolteae ATCC BAA-613

Site:
position = -91
score = 4.29257
sequence = CAGATTAGCACTTTCTAACTCT

Gene: CLOBOL_01420: Predicted iron-dependent repressor, DtxR family

Site:
position = -140
score = 5.22125
sequence = ATGTTTAGTGTATGCTATCTTT

Gene: CLOBOL_05596: Predicted iron-dependent repressor, DtxR family

Site:
position = -193
score = 4.41924
sequence = AAAGTTATGGTATCCTAACTGC

Gene: CLOBOL_00284: Predicted iron-dependent repressor, DtxR family
*
Clostridium nexile DSM 1787

Site:
position = -139
score = 6.02475
sequence = ATGGTTAGTATACTCTAACGTT

Gene: CLONEX_01968: Predicted iron-dependent repressor, DtxR family
*
Clostridium scindens ATCC 35704

Site:
position = -161
score = 5.53778
sequence = GTAGTTAGTATATTCTCATCAT

Gene: CLOSCI_00926: Predicted iron-dependent repressor, DtxR family
*
Ruminococcus lactaris ATCC 29176

Site:
position = -139
score = 4.13274
sequence = AATTATAACATAATCTATCAAT

Gene: RUMLAC_02635: Predicted iron-dependent repressor, DtxR family
*
Ruminococcus gnavus ATCC 29149

Site:
position = -102
score = 6.10894
sequence = TTAGTTAGTATATTCTAACATT

Gene: RUMGNA_03680: Predicted iron-dependent repressor, DtxR family
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_00530: Predicted iron-dependent repressor, DtxR family
*
Eubacterium rectale ATCC 33656

Site:
position = -180
score = 5.78984
sequence = ATAGTTAGTATACACTAACGCG

Gene: EUBREC_2328: Predicted iron-dependent repressor, DtxR family
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_20503: Predicted iron-dependent repressor, DtxR family
*
Dorea longicatena DSM 13814

Site:
position = -156
score = 6.31362
sequence = ATAGTTAGTATATGCTAACGTT

Gene: DORLON_00345: Predicted iron-dependent repressor, DtxR family
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00462: Predicted iron-dependent repressor, DtxR family
Predicted iron-dependent repressor, DtxR family
PF00881
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100022167: Putative nitroreductase
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_01421: Putative nitroreductase
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
Putative nitroreductase
 
CRON 5.
BACPEC_02635
 
Blautia hansenii DSM 20583
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -72
score = 5.93918
sequence = GTAATTAGAATAAACTAACAAT

Gene: BACPEC_02635: hypothetical protein
*
Bryantella formatexigens DSM 14469

Site:
position = -82
score = 6.22724
sequence = AATGTTAGCATATACTAACTTC

Gene: BRYFOR_03558: hypothetical protein
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -80
score = 4.3138
sequence = GCAGTTAGGATACCATAACTTT

Gene: Cbac1_010100004977: hypothetical protein
*
Clostridium bolteae ATCC BAA-613

Site:
position = -81
score = 4.3138
sequence = GCAGTTAGGATACCATAACTTT

Gene: CLOBOL_00283: hypothetical protein
*
Clostridium nexile DSM 1787

Site:
position = -65
score = 6.48145
sequence = AACGTTAGAGTATACTAACCAT

Gene: CLONEX_01967: hypothetical protein
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00838: hypothetical protein
*
Ruminococcus lactaris ATCC 29176

Site:
position = -132
score = 5.99532
sequence = CACGTTAGCGTATACTAACTAA

Gene: RUMLAC_01079: hypothetical protein
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_03678: hypothetical protein
*
Roseburia intestinalis L1-82

Site:
position = -71
score = 6.66813
sequence = AACGTTAGAATATACTAACCAA

Gene: ROSINTL182_04350: hypothetical protein
*
Eubacterium rectale ATCC 33656

Site:
position = -130
score = 5.03819
sequence = AAAGTAAGAAAAATCTAAAAAA

Site:
position = -90
score = 5.41777
sequence = CACGTTAGAGTATACTAACACC

Gene: EUBREC_1581: hypothetical protein
*
Eubacterium eligens ATCC 27750

Site:
position = -29
score = 5.78259
sequence = ACCATTAGAATATACTAACCGA

Gene: EUBELI_00572: hypothetical protein
*
Dorea longicatena DSM 13814

Site:
position = -120
score = 6.73931
sequence = AACGTTAGCATATACTAACTAT

Gene: DORLON_00346: hypothetical protein
 
Dorea formicigenerans ATCC 27755
hypothetical protein
feoA
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02636: Ferrous iron transport protein A
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_03559: Ferrous iron transport protein A
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100004972: Ferrous iron transport protein A
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_00282: Ferrous iron transport protein A
 
Clostridium nexile DSM 1787

Gene: CLONEX_01966: Ferrous iron transport protein A
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00837: Ferrous iron transport protein A
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01080: Ferrous iron transport protein A
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_03677: Ferrous iron transport protein A
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_04349: Ferrous iron transport protein A
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1582: Ferrous iron transport protein A
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00573: Ferrous iron transport protein A
 
Dorea longicatena DSM 13814

Gene: DORLON_00347: Ferrous iron transport protein A
 
Dorea formicigenerans ATCC 27755
Ferrous iron transport protein A
feoB
*
Blautia hansenii DSM 20583

Site:
position = -38
score = 4.3916
sequence = TGAGTTAGCATGAACTAATTGA

Gene: BLAHAN_00186: Ferrous iron transport protein B
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02637: Ferrous iron transport protein B
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_03560: Ferrous iron transport protein B
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100004967: Ferrous iron transport protein B
*2
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_00281: Ferrous iron transport protein B

Site:
position = -51
score = 4.96393
sequence = ATAGTTAGCGAAAGCTAATGAA

Site:
position = -31
score = 4.29449
sequence = AAAATAAGAAAAATATAACAAG

Gene: CLOBOL_05594: Ferrous iron transport protein B
*
Clostridium nexile DSM 1787

Site:
position = -58
score = 4.90601
sequence = ATGGTTAGTTAAAACTAATAAA

Gene: CLONEX_01965: Ferrous iron transport protein B
*2
Clostridium scindens ATCC 35704

Site:
position = -71
score = 6.14439
sequence = TACGTTAGTATATACTAATTAA

Gene: CLOSCI_00924: Ferrous iron transport protein B

Gene: CLOSCI_00836: Ferrous iron transport protein B
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01081: Ferrous iron transport protein B
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_03676: Ferrous iron transport protein B
*
Roseburia intestinalis L1-82

Site:
position = -121
score = 4.97382
sequence = GGCGTTAGCAAATGCTAACAAA

Gene: ROSINTL182_04347: Ferrous iron transport protein B
*
Eubacterium rectale ATCC 33656

Site:
position = -59
score = 5.39845
sequence = TAGGTTAGTAAATACAAACTAT

Gene: EUBREC_1583: Ferrous iron transport protein B
*
Eubacterium eligens ATCC 27750

Site:
position = -89
score = 5.41503
sequence = CAGGTTAGCATAATCTAATTAA

Gene: EUBELI_00574: Ferrous iron transport protein B
 
Dorea longicatena DSM 13814

Gene: DORLON_00348: Ferrous iron transport protein B
 
Dorea formicigenerans ATCC 27755
Ferrous iron transport protein B
BRYFOR_03561
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_03561: hypothetical protein
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01082: hypothetical protein
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814

Gene: DORLON_00349: hypothetical protein
 
Dorea formicigenerans ATCC 27755
hypothetical protein
RUMLAC_01083
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01083: hypothetical protein
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814

Gene: DORLON_00350: hypothetical protein
 
Dorea formicigenerans ATCC 27755
hypothetical protein
CLOSCI_00923
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00923: hypothetical protein
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814

Gene: DORLON_00351: hypothetical protein
 
Dorea formicigenerans ATCC 27755
hypothetical protein
DORLON_00352
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814

Gene: DORLON_00352: hypothetical protein
 
Dorea formicigenerans ATCC 27755
hypothetical protein
BACPEC_03058
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_03058: hypothetical protein
*
Bryantella formatexigens DSM 14469

Site:
position = -229
score = 4.72592
sequence = AAAAATAGCGTATACTAGTAAA

Site:
position = -209
score = 4.97723
sequence = AACGTTAGAGACTTCTAACTGT

Gene: BRYFOR_00504: hypothetical protein
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_05591: hypothetical protein
 
Clostridium nexile DSM 1787

Gene: CLONEX_01962: hypothetical protein
*
Clostridium scindens ATCC 35704

Site:
position = -171
score = 4.43938
sequence = ACAGTTAGCATTGACTATCTGA

Gene: CLOSCI_00921: hypothetical protein
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01086: hypothetical protein
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_03672: hypothetical protein
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_02495: hypothetical protein
*
Eubacterium rectale ATCC 33656

Site:
position = -53
score = 4.37003
sequence = CTTGTAAGTAAACTTTAACTAT

Gene: EUBREC_1233: hypothetical protein
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00577: hypothetical protein
 
Dorea longicatena DSM 13814

Gene: DORLON_00353: hypothetical protein
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_03340: hypothetical protein
hypothetical protein
COG2217
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_03059: Cation transporting ATPase
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_00503: Cation transporting ATPase
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100004947: Cation transporting ATPase
 2
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_05590: Cation transporting ATPase

Gene: CLOBOL_00279: Cation transporting ATPase
 
Clostridium nexile DSM 1787

Gene: CLONEX_01961: Cation transporting ATPase
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00920: Cation transporting ATPase
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01087: Cation transporting ATPase
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_03671: Cation transporting ATPase
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_02493: Cation transporting ATPase
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1234: Cation transporting ATPase
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00578: Cation transporting ATPase
 
Dorea longicatena DSM 13814

Gene: DORLON_00354: Cation transporting ATPase
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_03339: Cation transporting ATPase
Cation transporting ATPase
BACPEC_02991
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_03562: hypothetical protein
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100004957: heavy metal transport/detoxification protein
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01084: hypothetical protein
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
fur
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02639: Transcriptional regulator for iron transport and metabolism, Fur family
 
Bryantella formatexigens DSM 14469
*2
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100004962: Transcriptional regulator for iron transport and metabolism, Fur family

Site:
position = -216
score = 5.21277
sequence = ATAGTTAGCGTAAACTTACTGA

Site:
position = -65
score = 4.27907
sequence = ATGGTTAGTCAAAACTATTTCA

Gene: Cbac1_010100015165: Transcriptional regulator for iron transport and metabolism, Fur family
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_05592: Transcriptional regulator for iron transport and metabolism, Fur family
 
Clostridium nexile DSM 1787

Gene: CLONEX_01963: Transcriptional regulator for iron transport and metabolism, Fur family
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00922: Transcriptional regulator for iron transport and metabolism, Fur family
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01085: Transcriptional regulator for iron transport and metabolism, Fur family
*
Ruminococcus gnavus ATCC 29149

Site:
position = -85
score = 6.58007
sequence = AATGTTAGAATATACTAACTAA

Gene: RUMGNA_03679: Transcriptional regulator for iron transport and metabolism, Fur family
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_04345: Transcriptional regulator for iron transport and metabolism, Fur family
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1585: Transcriptional regulator for iron transport and metabolism, Fur family
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00576: Transcriptional regulator for iron transport and metabolism, Fur family
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
Transcriptional regulator for iron transport and metabolism, Fur family
Cbac1_010100004952
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100004952: hypothetical protein
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_00280: hypothetical protein
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
CLONEX_01964
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_01964: hypothetical protein
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_1584: hypothetical protein
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
BACPEC_02638
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02638: hypothetical protein
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
EUBELI_00575
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00575: hypothetical protein
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
BLAHAN_00185
*
Blautia hansenii DSM 20583

Site:
position = -67
score = 6.35697
sequence = AAAATTAGTATAAACTAACTTT

Gene: BLAHAN_00185: hypothetical protein
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
*
Clostridium bolteae ATCC BAA-613

Site:
position = -210
score = 4.80816
sequence = GATGTTAGAAAAATATAACTAA

Site:
position = -104
score = 5.72593
sequence = AAAGATAGCATACACTAAACAT

Gene: CLOBOL_05595: hypothetical protein
 
Clostridium nexile DSM 1787
*
Clostridium scindens ATCC 35704

Site:
position = -101
score = 5.80876
sequence = ATGATGAGAATATACTAACTAC

Gene: CLOSCI_00925: hypothetical protein
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
BLAHAN_00187
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00187: hypothetical protein
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
BLAHAN_00188
 
Blautia hansenii DSM 20583

Gene: BLAHAN_00188: hypothetical protein
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
ROSINTL182_04346
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_04346: hypothetical protein
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
CLOBOL_05593
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_05593: hypothetical protein
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
 
CRON 6.
eno
 
Blautia hansenii DSM 20583

Gene: BLAHAN_03002: Enolase (EC 4.2.1.11)
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02904: Enolase (EC 4.2.1.11)
*2
Bryantella formatexigens DSM 14469

Site:
position = -100
score = 5.56754
sequence = AAAGTTAGTTAAAACTAACTAA

Gene: BRYFOR_03081: Enolase (EC 4.2.1.11)

Gene: BRYFOR_04620: Enolase (EC 4.2.1.11)
*2
Clostridiales bacterium 1_7_47_FAA

Site:
position = -161
score = 5.17996
sequence = TTAGTTAGTAATAACTAACTTT

Gene: Cbac1_010100004917: Enolase (EC 4.2.1.11)

Gene: Cbac1_010100005852: Enolase (EC 4.2.1.11)
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03126: Enolase (EC 4.2.1.11)
 
Clostridium nexile DSM 1787

Gene: CLONEX_04118: Enolase (EC 4.2.1.11)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_04013: Enolase (EC 4.2.1.11)
*
Ruminococcus lactaris ATCC 29176

Site:
position = -107
score = 5.69582
sequence = ATGGTTAGTTAATACTAACTAT

Gene: RUMLAC_01886: Enolase (EC 4.2.1.11)
*2
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00850: Enolase (EC 4.2.1.11)

Site:
position = -123
score = 4.65431
sequence = AAGGTTAGCGATAACTAACTGA

Gene: RUMGNA_03923: Enolase (EC 4.2.1.11)
*2
Roseburia intestinalis L1-82

Site:
position = -55
score = 5.43867
sequence = ATAGTTAGACAAAACTAACAAT

Gene: ROSINTL182_03016: Enolase (EC 4.2.1.11)

Gene: ROSINTL182_01904: Enolase (EC 4.2.1.11)
*
Eubacterium rectale ATCC 33656

Site:
position = -112
score = 5.37156
sequence = TTAGTTAGATTAAACTAACTGT

Gene: EUBREC_2823: Enolase (EC 4.2.1.11)
*
Eubacterium eligens ATCC 27750

Site:
position = -176
score = 4.30484
sequence = AATTTATGTGTATACAAACTAA

Site:
position = -55
score = 5.85776
sequence = AAAGTTAGAAGAAACTAACTTA

Gene: EUBELI_01395: Enolase (EC 4.2.1.11)
*2
Dorea longicatena DSM 13814

Gene: DORLON_02368: Enolase (EC 4.2.1.11)

Site:
position = -108
score = 4.35216
sequence = AAAGATATGATATGCTGACGAT

Site:
position = -88
score = 6.41058
sequence = ATAGTTAGAATAATCTAACTAT

Gene: DORLON_00359: Enolase (EC 4.2.1.11)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_02537: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
 
CRON 7.
BLAHAN_03142
 
Blautia hansenii DSM 20583

Gene: BLAHAN_03142: hypothetical protein
 
Bacteroides pectinophilus ATCC 43243
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01111: hypothetical protein
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
*
Clostridium scindens ATCC 35704

Site:
position = -65
score = 4.37098
sequence = ATAGTTAGTCGCAACTAATAAT

Gene: CLOSCI_00929: hypothetical protein
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00570: hypothetical protein
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
COG0716
 
Blautia hansenii DSM 20583
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_02121: Flavodoxins
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01112: Flavodoxins
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100027064: Flavodoxins
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03815: Flavodoxins
 
Clostridium nexile DSM 1787

Gene: CLONEX_01941: Flavodoxins
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00928: Flavodoxins
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_00864: Flavodoxins
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_03289: Flavodoxins
*
Roseburia intestinalis L1-82

Site:
position = -133
score = 4.49646
sequence = TACAAAAGCATATTCTATCATT

Gene: ROSINTL182_04596: Flavodoxins
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_00571: Flavodoxins
 
Dorea longicatena DSM 13814

Gene: DORLON_00358: Flavodoxins
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00836: Flavodoxins
Flavodoxins
PF10087
*
Blautia hansenii DSM 20583

Site:
position = -99
score = 4.83286
sequence = GTAGTTAGTTAAAACTAATCAA

Site:
position = -38
score = 4.541
sequence = TAAGTTAGATAAGACTAATCAA

Gene: BLAHAN_03143: Uncharacterized protein conserved in bacteria
 
Bacteroides pectinophilus ATCC 43243
*
Bryantella formatexigens DSM 14469

Site:
position = -166
score = 5.74223
sequence = ACAGTTAGCATAAGCTAACTTA

Site:
position = -99
score = 5.12557
sequence = TAGGTTAGGAAAAACTAACTTA

Gene: BRYFOR_01110: Uncharacterized protein conserved in bacteria
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -105
score = 5.77372
sequence = ATAGTTAGTCAATACTAACCAT

Gene: Cbac1_010100005502: Uncharacterized protein conserved in bacteria
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_00927: Uncharacterized protein conserved in bacteria
*
Ruminococcus lactaris ATCC 29176

Site:
position = -77
score = 5.01337
sequence = TGAGTTAGAAAAGACTAACTAA

Gene: RUMLAC_01088: Uncharacterized protein conserved in bacteria
*
Ruminococcus gnavus ATCC 29149

Site:
position = -54
score = 4.65252
sequence = AAGGTTAGTTACAACTAACAAA

Gene: RUMGNA_03652: Uncharacterized protein conserved in bacteria
 
Roseburia intestinalis L1-82
 
Eubacterium rectale ATCC 33656
*
Eubacterium eligens ATCC 27750

Site:
position = -112
score = 4.8897
sequence = ATAGTTAGTTAAAGCTAACTGA

Gene: EUBELI_00569: Uncharacterized protein conserved in bacteria
*
Dorea longicatena DSM 13814

Site:
position = -48
score = 4.91131
sequence = TTAGTTAGATAAAGCTAACTAA

Gene: DORLON_00403: Uncharacterized protein conserved in bacteria
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_00835: Uncharacterized protein conserved in bacteria
Uncharacterized protein conserved in bacteria
BACPEC_02120
 
Blautia hansenii DSM 20583
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -44
score = 4.80638
sequence = AAGGTTAGTTATAACTAACTAA

Gene: BACPEC_02120: hypothetical protein
 
Bryantella formatexigens DSM 14469
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -54
score = 5.08201
sequence = TAGGTTAGCTTAAACTAACTGA

Gene: Cbac1_010100027059: hypothetical protein
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_03816: hypothetical protein
*
Clostridium nexile DSM 1787

Site:
position = -32
score = 4.86272
sequence = TAAGTTAGAAATAACTAACTCA

Gene: CLONEX_01942: hypothetical protein
 
Clostridium scindens ATCC 35704
 
Ruminococcus lactaris ATCC 29176
 
Ruminococcus gnavus ATCC 29149
*
Roseburia intestinalis L1-82

Site:
position = -89
score = 6.19891
sequence = AAAGTTAGTGTAATCTAACTAT

Site:
position = -24
score = 5.3978
sequence = GGAGTTAGGATAAACTAACTAT

Gene: ROSINTL182_04597: hypothetical protein
 
Eubacterium rectale ATCC 33656
 
Eubacterium eligens ATCC 27750
 
Dorea longicatena DSM 13814
 
Dorea formicigenerans ATCC 27755
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD