Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GulR - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process: Galactarate utilization; Glucarate utilization
Effector:
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913 7 2
Xylella fastidiosa 9a5c
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gulR
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -219
score = 5.63411
sequence = TTTGATACATAAATTGAATCGAT

Gene: XCC3246: Predicted galactarate/glucarate utilization regulator, LysR family
 
Xylella fastidiosa 9a5c
Predicted galactarate/glucarate utilization regulator, LysR family
 
CRON 2.
kdgD
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -101
score = 5.63411
sequence = ATCGATTCAATTTATGTATCAAA

Gene: XCC3245: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Xylella fastidiosa 9a5c
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC3244: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
 
Xylella fastidiosa 9a5c
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
gudP
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC3243: D-galactarate permease / D-glucarate permease
 
Xylella fastidiosa 9a5c
D-galactarate permease / D-glucarate permease
gudD
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC3242: Glucarate dehydratase (EC 4.2.1.40)
 
Xylella fastidiosa 9a5c
Glucarate dehydratase (EC 4.2.1.40)
omp
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC3241: Outer membrane porin protein 32 precursor
 
Xylella fastidiosa 9a5c
Outer membrane porin protein 32 precursor
garD
 
Stenotrophomonas maltophilia K279a
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC3240: D-galactarate dehydratase (EC 4.2.1.42)
 
Xylella fastidiosa 9a5c
D-galactarate dehydratase (EC 4.2.1.42)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD