Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GulR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process: Glucuronate utilization; Galacturonate utilization; Galactarate utilization; Glucarate utilization
Effector:
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis
Ralstonia eutropha H16
Ralstonia eutropha JMP134
Ralstonia metallidurans CH34
Ralstonia pickettii 12J 9 2
Ralstonia solanacearum GMI1000 10 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
kdgD
 
Cupriavidus taiwanensis

Gene: RALTA_B0137: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Ralstonia eutropha H16

Gene: H16_B0131: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Ralstonia eutropha JMP134

Gene: Reut_B3688: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Ralstonia metallidurans CH34

Gene: Rmet_4736: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
*
Ralstonia pickettii 12J

Site:
position = -106
score = 6.42004
sequence = ATCAATACAAGTTCTGTATTAAT

Site:
position = -341
score = 6.23245
sequence = ATCGATTCAAAAACGGTATGGAT

Gene: Rpic_4452: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
*
Ralstonia solanacearum GMI1000

Site:
position = -109
score = 6.37213
sequence = ATCGATTCAAAAAATGAATTGAT

Gene: RS05369: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J

Gene: Rpic_4451: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
 
Ralstonia solanacearum GMI1000

Gene: RS05368: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
gudP
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134

Gene: Reut_B3689: D-glucarate permease / D-galactarate permease
 
Ralstonia metallidurans CH34

Gene: Rmet_4735: D-glucarate permease / D-galactarate permease
 
Ralstonia pickettii 12J

Gene: Rpic_4450: D-glucarate permease / D-galactarate permease
 
Ralstonia solanacearum GMI1000

Gene: RSp0828: D-glucarate permease / D-galactarate permease
D-glucarate permease / D-galactarate permease
gudD2
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J

Gene: Rpic_4449: Glucarate dehydratase (EC 4.2.1.40)
 
Ralstonia solanacearum GMI1000

Gene: RSp0829: Glucarate dehydratase (EC 4.2.1.40)
Glucarate dehydratase (EC 4.2.1.40)
garD
 
Cupriavidus taiwanensis

Gene: RALTA_B0782: D-galactarate dehydratase (EC 4.2.1.42)
 
Ralstonia eutropha H16

Gene: H16_B0965: D-galactarate dehydratase (EC 4.2.1.42)
 
Ralstonia eutropha JMP134

Gene: Reut_B3690: D-galactarate dehydratase (EC 4.2.1.42)
 
Ralstonia metallidurans CH34

Gene: Rmet_4734: D-galactarate dehydratase (EC 4.2.1.42)
 
Ralstonia pickettii 12J

Gene: Rpic_4448: D-galactarate dehydratase (EC 4.2.1.42)
 
Ralstonia solanacearum GMI1000

Gene: RSp0830: D-galactarate dehydratase (EC 4.2.1.42)
D-galactarate dehydratase (EC 4.2.1.42)
udh
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J

Gene: Rpic_4447: Uronate dehydrogenase (EC 1.1.1.203)
 
Ralstonia solanacearum GMI1000

Gene: RS05364: Uronate dehydrogenase (EC 1.1.1.203)
Uronate dehydrogenase (EC 1.1.1.203)
uxuL
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J

Gene: Rpic_4446: Predicted glucuronolactone/galactarolactone lactonase
 
Ralstonia solanacearum GMI1000

Gene: RS05363: Predicted glucuronolactone/galactarolactone lactonase
Predicted glucuronolactone/galactarolactone lactonase
pgl
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000

Gene: RSp0833: Polygalacturonase (EC 3.2.1.15)
Polygalacturonase (EC 3.2.1.15)
exuT2
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J

Gene: Rpic_4445: Hexuronate transporter
 
Ralstonia solanacearum GMI1000

Gene: RSp0834: Hexuronate transporter
Hexuronate transporter
 
CRON 2.
gulR
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
*
Ralstonia pickettii 12J

Site:
position = -256
score = 6.42004
sequence = ATTAATACAGAACTTGTATTGAT

Site:
position = -21
score = 6.23245
sequence = ATCCATACCGTTTTTGAATCGAT

Gene: Rpic_4453: Predicted hexuronate/glucarate/galactarate utilization regulator, LysR family
 
Ralstonia solanacearum GMI1000

Gene: RS05372: Predicted hexuronate/glucarate/galactarate utilization regulator, LysR family
Predicted hexuronate/glucarate/galactarate utilization regulator, LysR family
 
CRON 3.
uxuL2
 
Cupriavidus taiwanensis
 
Ralstonia eutropha H16
 
Ralstonia eutropha JMP134
 
Ralstonia metallidurans CH34
 
Ralstonia pickettii 12J
*
Ralstonia solanacearum GMI1000

Site:
position = -111
score = 6.07767
sequence = ATCGATTCAAAACGTATATCGAT

Gene: RS05371: Predicted glucuronolactone/galactarolactone lactonase
Predicted glucuronolactone/galactarolactone lactonase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD