Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GulR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode:
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xanthobacter autotrophicus Py2
Azorhizobium caulinodans ORS 571 5 2
Nitrobacter winogradskyi Nb-255
Bradyrhizobium sp. BTAi1 10 5
Bradyrhizobium japonicum USDA 110 9 5
Rhodopseudomonas palustris CGA009
Mesorhizobium sp. BNC1
Bartonella quintana str. Toulouse
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Agrobacterium tumefaciens str. C58 (Cereon)
Rhizobium etli CFN 42
Rhizobium leguminosarum bv. viciae 3841
Rhizobium sp. NGR234
Sinorhizobium meliloti 1021
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gudP
 
Xanthobacter autotrophicus Py2
*
Azorhizobium caulinodans ORS 571

Site:
position = -304
score = 5.48988
sequence = ATCAATCCAAAAAATGGAATGAT

Gene: AZC_2640: D-glucarate permease / D-galactarate permease
 
Nitrobacter winogradskyi Nb-255
*
Bradyrhizobium sp. BTAi1

Site:
position = -105
score = 6.18422
sequence = ATCAATCCAATAATTGGATCGAT

Gene: BBta_6485: D-glucarate permease / D-galactarate permease
*
Bradyrhizobium japonicum USDA 110

Site:
position = -107
score = 6.08215
sequence = ATCAATCCAAAAACGGCATCGAT

Gene: blr5869: D-glucarate permease / D-galactarate permease
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
D-glucarate permease / D-galactarate permease
gulR
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2639: Predicted glucarate/galactarate utilization regulator, LysR family
 
Nitrobacter winogradskyi Nb-255
*
Bradyrhizobium sp. BTAi1

Site:
position = -21
score = 5.08401
sequence = ATCCATGCCGGGGAGGCATCGAT

Gene: BBta_6486: Predicted glucarate/galactarate utilization regulator, LysR family
*
Bradyrhizobium japonicum USDA 110

Site:
position = -21
score = 4.97114
sequence = ATTCATCTAAGGCATGTATCGAT

Gene: blr5870: Predicted glucarate/galactarate utilization regulator, LysR family
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
Predicted glucarate/galactarate utilization regulator, LysR family
 
CRON 2.
kdgD
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3371: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
*
Azorhizobium caulinodans ORS 571

Site:
position = -70
score = 5.4118
sequence = ACTGATCCCAAAAACGCATCGAT

Gene: AZC_2638: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Nitrobacter winogradskyi Nb-255
*
Bradyrhizobium sp. BTAi1

Site:
position = -141
score = 5.22867
sequence = ATTGATACCGACCCAGCATCAAT

Gene: BBta_6487: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
*
Bradyrhizobium japonicum USDA 110

Site:
position = -128
score = 5.35737
sequence = ATTGATGCTGATTTCGCATCGGT

Gene: blr5871: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1

Gene: Meso_1947: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3140: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Rhizobium etli CFN 42

Gene: RHE_CH02057: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL2335: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Rhizobium sp. NGR234

Gene: NGR_b07750: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Sinorhizobium meliloti 1021

Gene: SMa1440: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
gudD
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6488: Glucarate dehydratase (EC 4.2.1.40)
 
Bradyrhizobium japonicum USDA 110

Gene: blr5872: Glucarate dehydratase (EC 4.2.1.40)
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
Glucarate dehydratase (EC 4.2.1.40)
kgsD
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2637: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6489: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
 
Bradyrhizobium japonicum USDA 110

Gene: blr5873: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
garD
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2636: D-galactarate dehydratase (EC 4.2.1.42)
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_6490: D-galactarate dehydratase (EC 4.2.1.42)
 
Bradyrhizobium japonicum USDA 110

Gene: blr5874: D-galactarate dehydratase (EC 4.2.1.42)
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
D-galactarate dehydratase (EC 4.2.1.42)
 
CRON 3.
uxuF
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571
 
Nitrobacter winogradskyi Nb-255
*
Bradyrhizobium sp. BTAi1

Site:
position = -103
score = 5.94043
sequence = ATCAATACCGATCCTGCATCGAT

Gene: BBta_6297: Predicted uronate lactonase, PF10282 family
*
Bradyrhizobium japonicum USDA 110

Site:
position = -42
score = 5.7911
sequence = ACCGATACCATTTCGGCATCGAT

Gene: blr0368: Predicted uronate lactonase, PF10282 family
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
Predicted uronate lactonase, PF10282 family
 
CRON 4.
uxuP
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3368: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3338: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Nitrobacter winogradskyi Nb-255
*
Bradyrhizobium sp. BTAi1

Site:
position = -183
score = 6.22088
sequence = ATCGATGCAAGTCTTGCATTGAT

Gene: BBta_0128: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Bradyrhizobium japonicum USDA 110

Gene: bll6058: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3137: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4358: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021

Gene: SMb21353: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
uxuQ
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3367: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3337: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0129: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
 
Bradyrhizobium japonicum USDA 110

Gene: bll6057: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3136: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4359: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021

Gene: SMb21352: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
uxuM
 
Xanthobacter autotrophicus Py2

Gene: Xaut_3366: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
Azorhizobium caulinodans ORS 571

Gene: AZC_3336: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1

Gene: BBta_0130: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
Bradyrhizobium japonicum USDA 110

Gene: bll6056: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu3135: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4360: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021

Gene: SMb21351: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
 
CRON 5.
uxuP2
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
*
Bradyrhizobium japonicum USDA 110

Site:
position = -130
score = 5.73582
sequence = ATCCATACCTGAATTGGATCGAT

Site:
position = -151
score = 4.80007
sequence = ATCAATCTGCGTTCGGCATTGAT

Gene: bll6551: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
uxuQM2
 
Xanthobacter autotrophicus Py2
 
Azorhizobium caulinodans ORS 571
 
Nitrobacter winogradskyi Nb-255
 
Bradyrhizobium sp. BTAi1
 
Bradyrhizobium japonicum USDA 110

Gene: bll6550: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component / large permease component
 
Rhodopseudomonas palustris CGA009
 
Mesorhizobium sp. BNC1
 
Bartonella quintana str. Toulouse
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Sinorhizobium meliloti 1021
Predicted glucuronate /galacturonate TRAP-type transporter, small permease component / large permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD