Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AmtR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Nitrogen metabolism
Effector: GlnK-AMP, signal transduction protein
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 6 3
Streptomyces coelicolor A3(2)
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces scabiei 87.22 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
amtR
*
Streptomyces avermitilis MA-4680

Site:
position = -155
score = 7.88712
sequence = GATTTCTGTCGCCCGACAGAAATT

Gene: SAV_6701: Transcriptional regulator of urea utilization, TetR family
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -156
score = 7.88712
sequence = GATTTCTGTCGCGCGACAGAAATT

Gene: SCAB_73671: Transcriptional regulator of urea utilization, TetR family
Transcriptional regulator of urea utilization, TetR family
 
CRON 2.
uctT
*
Streptomyces avermitilis MA-4680

Site:
position = -35
score = 7.65539
sequence = AATTTCTGTCGCCCGACAGGAACT

Gene: SAV_6709: Urea carboxylase-related transporter, Amino acid permease family
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -78
score = 7.88712
sequence = AATTTCTGTCGCCCGACAGGAATT

Gene: SCAB_73751: Urea carboxylase-related transporter, Amino acid permease family
Urea carboxylase-related transporter, Amino acid permease family
 
CRON 3.
amt1
*
Streptomyces avermitilis MA-4680

Site:
position = -54
score = 7.65539
sequence = AATTTCTGTCGGGCGACAGAAATC

Gene: SAV_6700: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces scabiei 87.22

Site:
position = -126
score = 7.88712
sequence = AATTTCTGTCGCGCGACAGAAATC

Gene: SCAB_73661: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
amt2
 
Streptomyces avermitilis MA-4680

Gene: SAV_6699: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_73651: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
ucaA
 
Streptomyces avermitilis MA-4680

Gene: SAV_6698: Urea carboxylase (EC 6.3.4.6)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_73641: Urea carboxylase (EC 6.3.4.6)
Urea carboxylase (EC 6.3.4.6)
ucaB
 
Streptomyces avermitilis MA-4680

Gene: SAV_6697: Allophanate hydrolase (EC 3.5.1.54)
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_73631: Allophanate hydrolase (EC 3.5.1.54)
Allophanate hydrolase (EC 3.5.1.54)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD