Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodococcus erythropolis PR4 5 3
Nocardia farcinica IFM 10152 3 1
Rhodococcus opacus B4 5 3
Rhodococcus sp. RHA1 5 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sodA
*
Rhodococcus erythropolis PR4

Site:
position = -191
score = 5.87908
sequence = TAAGTTCGGTTAACCAAACTTT

Gene: RER_01640: Superoxide dismutase [Mn] (EC 1.15.1.1)
 
Nocardia farcinica IFM 10152
*
Rhodococcus opacus B4

Site:
position = -189
score = 5.76972
sequence = TTTTTTCGGGTGCCCGAACTTT

Gene: ROP_38900: Superoxide dismutase [Mn] (EC 1.15.1.1)
*
Rhodococcus sp. RHA1

Site:
position = -189
score = 5.76972
sequence = TTTTTTCGGGTGCCCGAACTTT

Gene: RHA1_ro04009: Superoxide dismutase [Mn] (EC 1.15.1.1)
Superoxide dismutase [Mn] (EC 1.15.1.1)
 
CRON 2.
mntH
*
Rhodococcus erythropolis PR4

Site:
position = -74
score = 6.1416
sequence = AAAGTTCGGCTCCCCGAACTCT

Gene: RER_51720: Manganese transport protein, NRAMP family
 
Nocardia farcinica IFM 10152
*
Rhodococcus opacus B4

Site:
position = -78
score = 5.32167
sequence = AAAGTTCGTGGTACCTAAATCT

Gene: ROP_51290: Manganese transport protein, NRAMP family
*
Rhodococcus sp. RHA1

Site:
position = -77
score = 5.22603
sequence = AAAGTTCGCCATACCTAAATCT

Gene: RHA1_ro05067: Manganese transport protein, NRAMP family
Manganese transport protein, NRAMP family
 
CRON 3.
mntC
*
Rhodococcus erythropolis PR4

Site:
position = -55
score = 5.19922
sequence = ATTGTTCGGCTATACGAACTTG

Gene: RER_59770: Manganese ABC transporter, periplasmic-binding protein
*
Nocardia farcinica IFM 10152

Site:
position = -35
score = 5.57012
sequence = AAAGTTAGGGCGTCCGAAAATT

Gene: nfa24340: Manganese ABC transporter, periplasmic-binding protein
*
Rhodococcus opacus B4

Site:
position = -52
score = 5.47351
sequence = TGGTTTCGGTGAACCGAACATT

Gene: ROP_70570: Manganese ABC transporter, periplasmic-binding protein
*
Rhodococcus sp. RHA1

Site:
position = -60
score = 5.45838
sequence = TGGTTTCGGCAAGCCGAACATT

Gene: RHA1_ro07271: Manganese ABC transporter, periplasmic-binding protein
Manganese ABC transporter, periplasmic-binding protein
mntA
 
Rhodococcus erythropolis PR4

Gene: RER_59760: Manganese ABC transporter, ATP-binding protein
 
Nocardia farcinica IFM 10152

Gene: nfa24350: Manganese ABC transporter, ATP-binding protein
 
Rhodococcus opacus B4

Gene: ROP_70560: Manganese ABC transporter, ATP-binding protein
 
Rhodococcus sp. RHA1

Gene: RHA1_ro07270: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mntB
 
Rhodococcus erythropolis PR4

Gene: RER_59750: Manganese ABC transporter, inner membrane permease protein
 
Nocardia farcinica IFM 10152

Gene: nfa24360: Manganese ABC transporter, inner membrane permease protein
 
Rhodococcus opacus B4

Gene: ROP_70550: Manganese ABC transporter, inner membrane permease protein
 
Rhodococcus sp. RHA1

Gene: RHA1_ro07269: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD