Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Enterococcaceae

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Enterococcus faecalis V583 3 2
Enterococcus faecium DO
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
grtP
*
Enterococcus faecalis V583

Site:
position = -100
score = 5.38569
sequence = TTTTGTGCATTTGAACAATA

Gene: EF2647: D-glycerate transporter, GntP family
 
Enterococcus faecium DO
D-glycerate transporter, GntP family
garK
 
Enterococcus faecalis V583

Gene: EF2646: Glycerate kinase (EC 2.7.1.31)
 
Enterococcus faecium DO
Glycerate kinase (EC 2.7.1.31)
 
CRON 2.
sdaR
*
Enterococcus faecalis V583

Site:
position = -153
score = 4.65749
sequence = CCTTGTGACTAAGAACTAAC

Gene: EF2645: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Enterococcus faecium DO
Glycerate utilization transcriptional regulator SdaR, SdaR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD