Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PaaR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces coelicolor A3(2) 13 5
Streptomyces avermitilis MA-4680 12 5
Streptomyces scabiei 87.22 12 5
Streptomyces griseus subsp. griseus NBRC 13350 11 5
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
paaI
*
Streptomyces coelicolor A3(2)

Site:
position = -152
score = 5.47039
sequence = CCCAACCGACCATTCGTTCGGT

Site:
position = -29
score = 5.58549
sequence = GCTAACCGAATGGTCGGTCGGG

Gene: SCO7470: Phenylacetic acid degradation protein PaaI, thioesterase
 
Streptomyces avermitilis MA-4680
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
Phenylacetic acid degradation protein PaaI, thioesterase
paaK
 
Streptomyces coelicolor A3(2)

Gene: SCO7469: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Streptomyces avermitilis MA-4680

Site:
position = -56
score = 4.96162
sequence = GGCTACCGAATGATCGGTCGCC

Gene: SAV_1257: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Streptomyces scabiei 87.22

Site:
position = -184
score = 5.21621
sequence = CCCAACCGACCATTCGTTCGGG

Site:
position = -52
score = 5.53762
sequence = AGCAACCGAATGGTCGGTCGGC

Gene: SCAB_82261: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -77
score = 5.36556
sequence = ATCGACCGAATGATCGGTCGCC

Gene: SGR_6814: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
 
CRON 2.
paaH
*
Streptomyces coelicolor A3(2)

Site:
position = -74
score = 5.79955
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SCO3834: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
*
Streptomyces avermitilis MA-4680

Site:
position = -74
score = 5.79955
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SAV_4359: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
*
Streptomyces scabiei 87.22

Site:
position = -74
score = 5.79955
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SCAB_45341: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
 
Streptomyces griseus subsp. griseus NBRC 13350
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaR
 
Streptomyces coelicolor A3(2)

Gene: SCO3833: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Streptomyces avermitilis MA-4680

Gene: SAV_4360: Transcriptional regulator of phenylacetic acid degradation, TetR family
 
Streptomyces scabiei 87.22

Gene: SCAB_45331: Transcriptional regulator of phenylacetic acid degradation, TetR family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -106
score = 5.79955
sequence = AGTAACCGAACGATCGGTCGGG

Gene: SGR_3746: Transcriptional regulator of phenylacetic acid degradation, TetR family
Transcriptional regulator of phenylacetic acid degradation, TetR family
 
CRON 3.
paaZ
*
Streptomyces coelicolor A3(2)

Site:
position = -106
score = 5.79955
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SCO3835: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Streptomyces avermitilis MA-4680

Site:
position = -96
score = 5.79955
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SAV_4358: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Streptomyces scabiei 87.22

Site:
position = -155
score = 5.79955
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SCAB_45351: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -72
score = 5.79955
sequence = CCCGACCGATCGTTCGGTTACT

Gene: SGR_3745: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
 
CRON 4.
bkdA
*
Streptomyces coelicolor A3(2)

Site:
position = -78
score = 5.59368
sequence = GACGACCGAACAATCGGTAGGT

Gene: SCO3831: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Streptomyces avermitilis MA-4680

Site:
position = -77
score = 5.59368
sequence = GACGACCGAACAATCGGTAGGT

Gene: SAV_4362: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Streptomyces scabiei 87.22

Site:
position = -77
score = 5.87908
sequence = AACGACCGAACAATCGGTAGGT

Gene: SCAB_45311: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -127
score = 5.52512
sequence = CGCGACCGAACAATCGGTAGGT

Gene: SGR_3748: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
bkdB
 
Streptomyces coelicolor A3(2)

Gene: SCO3830: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Streptomyces avermitilis MA-4680

Gene: SAV_4363: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Streptomyces scabiei 87.22

Gene: SCAB_45301: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3749: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
bkdC
 
Streptomyces coelicolor A3(2)

Gene: SCO3829: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Streptomyces avermitilis MA-4680

Gene: SAV_4364: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Streptomyces scabiei 87.22

Gene: SCAB_45291: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3750: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
CRON 5.
paaA
*
Streptomyces coelicolor A3(2)

Site:
position = -157
score = 5.58549
sequence = CCCGACCGACCATTCGGTTAGC

Site:
position = -34
score = 5.47039
sequence = ACCGAACGAATGGTCGGTTGGG

Gene: SCO7471: Phenylacetate-CoA oxygenase, PaaA subunit
*
Streptomyces avermitilis MA-4680

Site:
position = -48
score = 5.80462
sequence = ACCGAACGATCGGTCGGTCGGT

Gene: SAV_4354: Phenylacetate-CoA oxygenase, PaaA subunit
*
Streptomyces scabiei 87.22

Site:
position = -34
score = 5.21621
sequence = CCCGAACGAATGGTCGGTTGGG

Site:
position = -166
score = 5.53762
sequence = GCCGACCGACCATTCGGTTGCT

Gene: SCAB_82281: Phenylacetate-CoA oxygenase, PaaA subunit
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -34
score = 5.62079
sequence = AGGAACCGAACGATCGGTCGGT

Gene: SGR_3741: Phenylacetate-CoA oxygenase, PaaA subunit
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
 
Streptomyces coelicolor A3(2)

Gene: SCO7472: Phenylacetate-CoA oxygenase, PaaB subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4353: Phenylacetate-CoA oxygenase, PaaB subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_82291: Phenylacetate-CoA oxygenase, PaaB subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3740: Phenylacetate-CoA oxygenase, PaaB subunit
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
 
Streptomyces coelicolor A3(2)

Gene: SCO7473: Phenylacetate-CoA oxygenase, PaaC subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4352: Phenylacetate-CoA oxygenase, PaaC subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_82301: Phenylacetate-CoA oxygenase, PaaC subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3739: Phenylacetate-CoA oxygenase, PaaC subunit
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
 
Streptomyces coelicolor A3(2)

Gene: SCO7474: Phenylacetate-CoA oxygenase, PaaD subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4351: Phenylacetate-CoA oxygenase, PaaD subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_82311: Phenylacetate-CoA oxygenase, PaaD subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3738: Phenylacetate-CoA oxygenase, PaaD subunit
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
 
Streptomyces coelicolor A3(2)

Gene: SCO7475: Phenylacetate-CoA oxygenase, PaaE subunit
 
Streptomyces avermitilis MA-4680

Gene: SAV_4350: Phenylacetate-CoA oxygenase, PaaE subunit
 
Streptomyces scabiei 87.22

Gene: SCAB_82321: Phenylacetate-CoA oxygenase, PaaE subunit
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3737: Phenylacetate-CoA oxygenase, PaaE subunit
Phenylacetate-CoA oxygenase, PaaE subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD