Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Listeriaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Listeria innocua Clip11262 4 2
Listeria monocytogenes EGD-e 4 2
Listeria seeligeri serovar 1/2b str. SLCC3954 4 2
Listeria welshimeri serovar 6b str. SLCC5334 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntH
*
Listeria innocua Clip11262

Site:
position = -51
score = 6.41751
sequence = AATGTTTCCCGTAGTAAACTTT

Gene: lin1463: Manganese transport protein MntH
*
Listeria monocytogenes EGD-e

Site:
position = -51
score = 6.41751
sequence = AATGTTTCCCGTAGTAAACTTT

Gene: lmo1424: Manganese transport protein MntH
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -51
score = 6.41751
sequence = AATGTTTCCCGTAGTAAACTTT

Gene: lse_1343: Manganese transport protein MntH
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -51
score = 6.41751
sequence = AATGTTTCCCGTAGTAAACTTT

Gene: lwe1441: Manganese transport protein MntH
Manganese transport protein MntH
 
CRON 2.
mntB
*
Listeria innocua Clip11262

Site:
position = -68
score = 6.32512
sequence = AAAGTTGCATTAAGGAAACATT

Gene: lin1963: Manganese ABC transporter, inner membrane permease protein
*
Listeria monocytogenes EGD-e

Site:
position = -68
score = 6.41729
sequence = AAAGTTGCTCTAAGGAAACATT

Gene: lmo1849: Manganese ABC transporter, inner membrane permease protein
*
Listeria seeligeri serovar 1/2b str. SLCC3954

Site:
position = -69
score = 6.41729
sequence = AAAGTTGCTCTAAGGAAACATT

Gene: lse_1829: Manganese ABC transporter, inner membrane permease protein
*
Listeria welshimeri serovar 6b str. SLCC5334

Site:
position = -68
score = 6.41729
sequence = AAAGTTGCTCTAAGGAAACATT

Gene: lwe1868: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
mntC
 
Listeria innocua Clip11262

Gene: lin1962: Manganese ABC transporter, inner membrane permease protein
 
Listeria monocytogenes EGD-e

Gene: lmo1848: Manganese ABC transporter, inner membrane permease protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1828: Manganese ABC transporter, inner membrane permease protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1867: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
mntA
 
Listeria innocua Clip11262

Gene: lin1961: Manganese ABC transporter, inner membrane permease protein
 
Listeria monocytogenes EGD-e

Gene: lmo1847: Manganese ABC transporter, inner membrane permease protein
 
Listeria seeligeri serovar 1/2b str. SLCC3954

Gene: lse_1827: Manganese ABC transporter, inner membrane permease protein
 
Listeria welshimeri serovar 6b str. SLCC5334

Gene: lwe1866: Manganese ABC transporter, inner membrane permease protein
Manganese ABC transporter, inner membrane permease protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD