Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SdaR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magneticum AMB-1
Magnetospirillum magnetotacticum MS-1
Azospirillum sp. B510 2 1
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5 3 2
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
garK
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
*
Azospirillum sp. B510

Site:
position = -134
score = 5.68486
sequence = TTTTGGAGATTTGCACAAAG

Gene: AZL_a08400: Glycerate kinase (EC 2.7.1.31)
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1380: Glycerate kinase (EC 2.7.1.31)
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Glycerate kinase (EC 2.7.1.31)
sdaR
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Azospirillum sp. B510

Gene: AZL_a08410: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -73
score = 6.47826
sequence = CTTTGTGCATCTGCACTAAA

Gene: Gdia_1382: Glycerate utilization transcriptional regulator SdaR, SdaR family
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Glycerate utilization transcriptional regulator SdaR, SdaR family
grtT
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -128
score = 6.47826
sequence = TTTAGTGCAGATGCACAAAG

Gene: Gdia_1381: Predicted D-glycerate transporter, MFS family
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
Predicted D-glycerate transporter, MFS family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD