Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ZntR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Zinc resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 2 1
Shewanella putrefaciens CN-32 2 1
Shewanella sp W3-18-1 2 1
Shewanella sp ANA-3 2 1
Shewanella sp MR-4 2 1
Shewanella sp MR-7 2 1
Shewanella baltica OS155 2 1
Shewanella denitrificans OS217 2 1
Shewanella frigidimarina NCIMB 400 2 1
Shewanella amazonensis SB2B 2 1
Shewanella loihica PV-4 2 1
Shewanella pealeana ATCC 700345 2 1
Shewanella halifaxensis HAW-EB4 2 1
Shewanella piezotolerans WP3 1 1
Shewanella sediminis HAW-EB3 2 1
Shewanella woodyi ATCC 51908 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zntR
*
Shewanella oneidensis MR-1

Site:
position = -94
score = 6.9617
sequence = ACCTTGGAGTAGGCTCCAAGGT

Gene: SO_0443: Zinc resistance transcriptional regulator, MerR family
*
Shewanella putrefaciens CN-32

Site:
position = -84
score = 6.9617
sequence = ACCTTGGAGTAGGCTCCAAGGT

Gene: Sputcn32_3400: Zinc resistance transcriptional regulator, MerR family
*
Shewanella sp W3-18-1

Site:
position = -84
score = 6.9617
sequence = ACCTTGGAGTAGGCTCCAAGGT

Gene: Sputw3181_0543: Zinc resistance transcriptional regulator, MerR family
*
Shewanella sp ANA-3

Site:
position = -94
score = 6.82534
sequence = ACCTTGGAGTAGGCTCTAAGGT

Gene: Shewana3_0442: Zinc resistance transcriptional regulator, MerR family
*
Shewanella sp MR-4

Site:
position = -95
score = 6.82534
sequence = ACCTTGGAGTAGGCTCTAAGGT

Gene: Shewmr4_0446: Zinc resistance transcriptional regulator, MerR family
*
Shewanella sp MR-7

Site:
position = -95
score = 6.82534
sequence = ACCTTGGAGTAGGCTCTAAGGT

Gene: Shewmr7_3583: Zinc resistance transcriptional regulator, MerR family
*
Shewanella baltica OS155

Site:
position = -96
score = 6.9617
sequence = ACCTTGGAGTAGGCTCCAAGGT

Gene: Sbal_0421: Zinc resistance transcriptional regulator, MerR family
*
Shewanella denitrificans OS217

Site:
position = -72
score = 7.03688
sequence = ACCTTAGATTAAACTCCAAGGT

Gene: Sden_3408: Zinc resistance transcriptional regulator, MerR family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -64
score = 7.17324
sequence = ACCTTGGATTAAACTCCAAGGT

Gene: Sfri_0494: Zinc resistance transcriptional regulator, MerR family
*
Shewanella amazonensis SB2B

Site:
position = -59
score = 7.17324
sequence = ACCTTGGATTAAACTCCAAGGT

Gene: Sama_0396: Zinc resistance transcriptional regulator, MerR family
*
Shewanella loihica PV-4

Site:
position = -66
score = 6.94117
sequence = ACCTTAGATTTAACTCTAAGGT

Gene: Shew_3411: Zinc resistance transcriptional regulator, MerR family
*
Shewanella pealeana ATCC 700345

Site:
position = -125
score = 6.77971
sequence = ACCTTGGATACAACTCCAAGGT

Gene: Spea_0433: Zinc resistance transcriptional regulator, MerR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -115
score = 6.77971
sequence = ACCTTGGATACAACTCCAAGGT

Gene: Shal_0489: Zinc resistance transcriptional regulator, MerR family
*
Shewanella piezotolerans WP3

Site:
position = -96
score = 6.77971
sequence = ACCTTGGATACAACTCCAAGGT

Gene: swp_4723: Zinc resistance transcriptional regulator, MerR family
*
Shewanella sediminis HAW-EB3

Site:
position = -73
score = 7.07754
sequence = ACCTTAGATTTAACTCCAAGGT

Gene: Ssed_0445: Zinc resistance transcriptional regulator, MerR family
*
Shewanella woodyi ATCC 51908

Site:
position = -73
score = 7.07754
sequence = ACCTTGGATTTAACTCTAAGGT

Gene: Swoo_0297: Zinc resistance transcriptional regulator, MerR family
Zinc resistance transcriptional regulator, MerR family
PF03773
 
Shewanella oneidensis MR-1

Gene: SO_0444: Putative permease of unknown function DUF318
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_3399: Putative permease of unknown function DUF318
 
Shewanella sp W3-18-1

Gene: Sputw3181_0544: Putative permease of unknown function DUF318
 
Shewanella sp ANA-3

Gene: Shewana3_0443: Putative permease of unknown function DUF318
 
Shewanella sp MR-4

Gene: Shewmr4_0447: Putative permease of unknown function DUF318
 
Shewanella sp MR-7

Gene: Shewmr7_3582: Putative permease of unknown function DUF318
 
Shewanella baltica OS155

Gene: Sbal_0422: Putative permease of unknown function DUF318
 
Shewanella denitrificans OS217

Gene: Sden_3409: Putative permease of unknown function DUF318
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0495: Putative permease of unknown function DUF318
 
Shewanella amazonensis SB2B

Gene: Sama_0397: Putative permease of unknown function DUF318
 
Shewanella loihica PV-4

Gene: Shew_3410: Putative permease of unknown function DUF318
 
Shewanella pealeana ATCC 700345

Gene: Spea_0434: Putative permease of unknown function DUF318
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0490: Putative permease of unknown function DUF318
 
Shewanella piezotolerans WP3

Gene: swp_4720: Putative permease of unknown function DUF318
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0446: Putative permease of unknown function DUF318
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0298: Putative permease of unknown function DUF318
Putative permease of unknown function DUF318
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD