Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces scabiei 87.22 12 4
Streptomyces griseus subsp. griseus NBRC 13350 10 3
Streptomyces coelicolor A3(2) 16 5
Streptomyces avermitilis MA-4680 11 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpmG2
*
Streptomyces scabiei 87.22

Site:
position = -31
score = 5.89902
sequence = AAATGGAATTCATTTTCAGTA

Gene: SCAB_40001: LSU ribosomal protein L33p
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -31
score = 5.64458
sequence = AAATGGAAACCATTGCCATAT

Gene: SGR_546: LSU ribosomal protein L33p
*
Streptomyces coelicolor A3(2)

Site:
position = -31
score = 5.89251
sequence = TAATGGAATTCATTTTCAGTA

Gene: SCO3428: LSU ribosomal protein L33p
*
Streptomyces avermitilis MA-4680

Site:
position = -31
score = 5.68699
sequence = AAATGGAAGTCGTTTTCAGTA

Gene: SAV_4643: LSU ribosomal protein L33p
LSU ribosomal protein L33p
rpmE2
 
Streptomyces scabiei 87.22

Gene: SCAB_39991: LSU ribosomal protein L31p
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_547: LSU ribosomal protein L31p
 
Streptomyces coelicolor A3(2)

Gene: SCO3427: LSU ribosomal protein L31p
 
Streptomyces avermitilis MA-4680

Gene: SAV_4644: LSU ribosomal protein L31p
LSU ribosomal protein L31p
yciC
 
Streptomyces scabiei 87.22

Gene: SCAB_39981: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_548: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Streptomyces coelicolor A3(2)

Gene: SCO3426: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Streptomyces avermitilis MA-4680

Gene: SAV_4645: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpsR2
 
Streptomyces scabiei 87.22

Gene: SCAB_39971: SSU ribosomal protein S18p
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_549: SSU ribosomal protein S18p
 
Streptomyces coelicolor A3(2)

Gene: SCO3425: SSU ribosomal protein S18p
 
Streptomyces avermitilis MA-4680

Gene: SAV_4646: SSU ribosomal protein S18p
SSU ribosomal protein S18p
 
CRON 2.
znuB2
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces coelicolor A3(2)

Site:
position = -34
score = 4.8663
sequence = TGTTGAACATGATTTTCATTG

Gene: SCO0475: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Streptomyces avermitilis MA-4680
Zinc ABC transporter, inner membrane permease protein ZnuB
SCO0474
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO0474: WD40/YVTN repeat-like-containing domain
 
Streptomyces avermitilis MA-4680
WD40/YVTN repeat-like-containing domain
znuA2
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO0473: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Streptomyces avermitilis MA-4680
Zinc ABC transporter, periplasmic-binding protein ZnuA
SCO0472
 
Streptomyces scabiei 87.22
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces coelicolor A3(2)

Gene: SCO0472: WD40/YVTN repeat-like-containing domain
 
Streptomyces avermitilis MA-4680
WD40/YVTN repeat-like-containing domain
 
CRON 3.
znuA
*
Streptomyces scabiei 87.22

Site:
position = -17
score = 5.05355
sequence = AGATGAAAATGACTGTCATGA

Site:
position = -39
score = 5.03163
sequence = TGTTGACAATCGTTTCCAGAT

Gene: SCAB_61981: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -39
score = 4.96135
sequence = TGTTGACAATCGTTTCCACTT

Site:
position = -17
score = 4.579
sequence = AGTTGAAAATGAGTGTCATGA

Gene: SGR_5019: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Streptomyces coelicolor A3(2)

Site:
position = -17
score = 4.57249
sequence = TGTTGAAAATGAGTGTCATGA

Site:
position = -39
score = 5.0155
sequence = TGTTGACAACGGTTTCCATAT

Gene: SCO2505: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Streptomyces avermitilis MA-4680

Site:
position = -39
score = 5.26889
sequence = TGTTGACAATCGTTTCCAGTT

Site:
position = -17
score = 4.81695
sequence = TGTTGAAAATGACTGTCATGA

Gene: SAV_5634: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Streptomyces scabiei 87.22

Gene: SCAB_61971: Zinc ABC transporter, ATP-binding protein ZnuC
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5018: Zinc ABC transporter, ATP-binding protein ZnuC
 
Streptomyces coelicolor A3(2)

Gene: SCO2506: Zinc ABC transporter, ATP-binding protein ZnuC
 
Streptomyces avermitilis MA-4680

Gene: SAV_5633: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Streptomyces scabiei 87.22

Gene: SCAB_61961: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5017: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Streptomyces coelicolor A3(2)

Gene: SCO2507: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Streptomyces avermitilis MA-4680

Gene: SAV_5632: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Streptomyces scabiei 87.22

Gene: SCAB_61951: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5016: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Streptomyces coelicolor A3(2)

Gene: SCO2508: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Streptomyces avermitilis MA-4680

Gene: SAV_5631: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 4.
rpmB2
*
Streptomyces scabiei 87.22

Site:
position = -66
score = 5.89902
sequence = TACTGAAAATGAATTCCATTT

Gene: SCAB_40011: LSU ribosomal protein L28p
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -58
score = 5.64458
sequence = ATATGGCAATGGTTTCCATTT

Gene: SGR_545: LSU ribosomal protein L28p
*
Streptomyces coelicolor A3(2)

Site:
position = -62
score = 5.89251
sequence = TACTGAAAATGAATTCCATTA

Gene: SCO3429: LSU ribosomal protein L28p
*
Streptomyces avermitilis MA-4680

Site:
position = -75
score = 5.68699
sequence = TACTGAAAACGACTTCCATTT

Gene: SAV_4642: LSU ribosomal protein L28p
LSU ribosomal protein L28p
rpsN2
 
Streptomyces scabiei 87.22

Gene: SCAB_40021: SSU ribosomal protein S14p
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_544: SSU ribosomal protein S14p
 
Streptomyces coelicolor A3(2)

Gene: SCO3430: SSU ribosomal protein S14p
 
Streptomyces avermitilis MA-4680

Gene: SAV_4641: SSU ribosomal protein S14p
SSU ribosomal protein S14p
SC03431
 
Streptomyces scabiei 87.22

Gene: SCAB_40031: possible membrane protein
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_4067: possible membrane protein
 
Streptomyces coelicolor A3(2)

Gene: SCO3431: possible membrane protein
 
Streptomyces avermitilis MA-4680

Gene: SAV_4640: possible membrane protein
possible membrane protein
 
CRON 5.
rpmF2
*
Streptomyces scabiei 87.22

Site:
position = -64
score = 5.11035
sequence = TAATGGGATCCATTTTCATGT

Gene: SCAB_41531: LSU ribosomal protein L32p
 
Streptomyces griseus subsp. griseus NBRC 13350
*
Streptomyces coelicolor A3(2)

Site:
position = -56
score = 4.99167
sequence = ACATGAACATCGTTTTCATGT

Gene: SCO0436: LSU ribosomal protein L32p
 
Streptomyces avermitilis MA-4680
LSU ribosomal protein L32p
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD