Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog QorR - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152
Rhodococcus erythropolis PR4 2 2
Rhodococcus opacus B4 2 2
Rhodococcus sp. RHA1 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
qorB
 
Nocardia farcinica IFM 10152
*
Rhodococcus erythropolis PR4

Site:
position = -70
score = 6.68421
sequence = GCACTTACGAAAAATAAGTGC

Gene: RER_15420: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
*
Rhodococcus opacus B4

Site:
position = -78
score = 6.57116
sequence = GCACTTACGAAAAATTAGTGC

Gene: ROP_18550: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
*
Rhodococcus sp. RHA1

Site:
position = -79
score = 6.57116
sequence = GCACTTACGAAAAATTAGTGC

Gene: RHA1_ro02137: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
 
CRON 2.
qorR
 
Nocardia farcinica IFM 10152
*
Rhodococcus erythropolis PR4

Site:
position = -69
score = 6.68421
sequence = GCACTTATTTTTCGTAAGTGC

Gene: RER_15410: Redox-sensing transcriptional regulator QorR, HxlR family
*
Rhodococcus opacus B4

Site:
position = -66
score = 6.57116
sequence = GCACTAATTTTTCGTAAGTGC

Gene: ROP_18560: Redox-sensing transcriptional regulator QorR, HxlR family
*
Rhodococcus sp. RHA1

Site:
position = -66
score = 6.57116
sequence = GCACTAATTTTTCGTAAGTGC

Gene: RHA1_ro02138: Redox-sensing transcriptional regulator QorR, HxlR family
Redox-sensing transcriptional regulator QorR, HxlR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD