Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArsR - Nocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nocardia farcinica IFM 10152 8 2
Rhodococcus erythropolis PR4 11 2
Rhodococcus opacus B4 10 2
Rhodococcus sp. RHA1 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
arsR
*2
Nocardia farcinica IFM 10152

Site:
position = -13
score = 6.46324
sequence = TCAATATCGATGCATGTCTA

Gene: nfa24490: Arsenical resistance operon repressor, ArsR family

Site:
position = -13
score = 6.75266
sequence = TCAATATTGGCGTATGTCGA

Gene: pnf2240: Arsenical resistance operon repressor, ArsR family
*2
Rhodococcus erythropolis PR4

Site:
position = -13
score = 6.90937
sequence = TCAATATCGAAGAATGTCGA

Gene: RER_35210: Arsenical resistance operon repressor, ArsR family

Site:
position = -28
score = 6.92377
sequence = TCAATATTGATGTATGTCGA

Gene: pREL1_0158: Arsenical resistance operon repressor, ArsR family
*2
Rhodococcus opacus B4

Site:
position = -13
score = 7.12383
sequence = TCAATATCGACGCATGTCGA

Gene: ROP_29950: Arsenical resistance operon repressor, ArsR family

Site:
position = -13
score = 7.18905
sequence = TCAATATCGACGTATGTCGA

Gene: ROP_00150: Arsenical resistance operon repressor, ArsR family
*
Rhodococcus sp. RHA1

Site:
position = -13
score = 7.12383
sequence = TCAATATCGACGCATGTCGA

Gene: RHA1_ro03367: Arsenical resistance operon repressor, ArsR family
Arsenical resistance operon repressor, ArsR family
arsB
 2
Nocardia farcinica IFM 10152

Gene: pnf2250: Arsenate reductase (EC 1.20.4.1)

Gene: nfa24500: Arsenate reductase (EC 1.20.4.1)
 2
Rhodococcus erythropolis PR4

Gene: RER_35200: Arsenate reductase (EC 1.20.4.1)

Gene: pREL1_0159: Arsenate reductase (EC 1.20.4.1)
 2
Rhodococcus opacus B4

Gene: ROP_00160: Arsenate reductase (EC 1.20.4.1)

Gene: ROP_29960: Arsenate reductase (EC 1.20.4.1)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro03368: Arsenate reductase (EC 1.20.4.1)
Arsenate reductase (EC 1.20.4.1)
arsC
 4
Nocardia farcinica IFM 10152

Gene: pnf2280: Arsenate reductase (EC 1.20.4.1)

Gene: nfa24510: Arsenate reductase (EC 1.20.4.1)

Gene: pnf2260: Arsenate reductase (EC 1.20.4.1)

Gene: pnf2270: Arsenate reductase (EC 1.20.4.1)
 3
Rhodococcus erythropolis PR4

Gene: RER_35190: Arsenate reductase (EC 1.20.4.1)

Gene: pREL1_0162: Arsenate reductase (EC 1.20.4.1)

Gene: pREL1_0160: Arsenate reductase (EC 1.20.4.1)
 4
Rhodococcus opacus B4

Gene: ROP_00180: Arsenate reductase (EC 1.20.4.1)

Gene: ROP_00190: Arsenate reductase (EC 1.20.4.1)

Gene: ROP_00170: Arsenate reductase (EC 1.20.4.1)

Gene: ROP_29970: Arsenate reductase (EC 1.20.4.1)
 
Rhodococcus sp. RHA1

Gene: RHA1_ro03369: Arsenate reductase (EC 1.20.4.1)
Arsenate reductase (EC 1.20.4.1)
trxB
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4

Gene: pREL1_0161: Thioredoxin reductase (EC 1.8.1.9)
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
Thioredoxin reductase (EC 1.8.1.9)
pREL1_0163
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4

Gene: pREL1_0163: Monooxygenase, putative
 
Rhodococcus opacus B4
 
Rhodococcus sp. RHA1
Monooxygenase, putative
arsD
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4

Gene: pREL1_0164: Arsenical resistance operon trans-acting repressor arsD
 
Rhodococcus opacus B4

Gene: ROP_00200: Arsenical resistance operon trans-acting repressor arsD
 
Rhodococcus sp. RHA1
Arsenical resistance operon trans-acting repressor arsD
arsA
 
Nocardia farcinica IFM 10152
 
Rhodococcus erythropolis PR4

Gene: pREL1_0165: Arsenical pump-driving ATPase (EC 3.6.3.16)
 
Rhodococcus opacus B4

Gene: ROP_00210: Arsenical pump-driving ATPase (EC 3.6.3.16)
 
Rhodococcus sp. RHA1
Arsenical pump-driving ATPase (EC 3.6.3.16)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD