Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Mycobacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Mycobacterium smegmatis str. MC2 155 3 2
Mycobacterium marinum M 2 2
Mycobacterium leprae TN
Mycobacterium flavescens PYR-GCK 4 2
Mycobacterium avium 104 2 1
Mycobacterium abscessus ATCC 19977 1 1
Mycobacterium sp. JLS 3 2
Mycobacterium tuberculosis H37Rv 1 1
Mycobacterium vanbaalenii PYR-1 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mtsA
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
*
Mycobacterium flavescens PYR-GCK

Site:
position = -35
score = 4.88737
sequence = AGTTTCGGCGACCCGAAATC

Gene: Mflv_3168: Manganese ABC transporter, substrate-binding protein
 
Mycobacterium avium 104
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -61
score = 5.25207
sequence = GTTTTCGGTCACCCAAACTT

Gene: Mvan_3371: Manganese ABC transporter, substrate-binding protein
Manganese ABC transporter, substrate-binding protein
mtsB
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_3167: Manganese ABC transporter, ATP-binding protein
 
Mycobacterium avium 104
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_3370: Manganese ABC transporter, ATP-binding protein
Manganese ABC transporter, ATP-binding protein
mtsC
 
Mycobacterium smegmatis str. MC2 155
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_3166: Manganese ABC transporter, substrate-binding protein
 
Mycobacterium avium 104
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium sp. JLS
 
Mycobacterium tuberculosis H37Rv
 
Mycobacterium vanbaalenii PYR-1

Gene: Mvan_3369: Manganese ABC transporter, substrate-binding protein
Manganese ABC transporter, substrate-binding protein
 
CRON 2.
mntH
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -53
score = 6.84888
sequence = GATTTCGGCTAACCTAACTT

Gene: MSMEG_5589: Manganese transport protein MntH
*
Mycobacterium marinum M

Site:
position = -54
score = 5.50927
sequence = TGTTTCGGCTAGCCTCACTT

Gene: MMAR_4584: Manganese transport protein MntH
 
Mycobacterium leprae TN

Gene: ML2098: Manganese transport protein MntH
*
Mycobacterium flavescens PYR-GCK

Site:
position = -54
score = 6.11247
sequence = GGTTTCGTCTGGCCTAACTT

Gene: Mflv_1822: Manganese transport protein MntH
*
Mycobacterium avium 104

Site:
position = -52
score = 4.63707
sequence = ATGTTCGACTACCCTCACTT

Gene: MAV_1044: Manganese transport protein MntH
*
Mycobacterium abscessus ATCC 19977

Site:
position = -53
score = 5.39578
sequence = AGTTTCGGCTACTCTAACTT

Gene: MAB_1031c: Manganese transport protein MntH
*
Mycobacterium sp. JLS

Site:
position = -51
score = 6.66303
sequence = GTTTTCGGCTAACCTAACTT

Gene: Mjls_4747: Manganese transport protein MntH
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0924c: Manganese transport protein MntH
 
Mycobacterium vanbaalenii PYR-1
Manganese transport protein MntH
PF05908
 
Mycobacterium smegmatis str. MC2 155

Gene: MSMEG_5591: Protein of unknown function DUF867
 
Mycobacterium marinum M
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK
 
Mycobacterium avium 104

Gene: MAV_1043: Protein of unknown function DUF867
 
Mycobacterium abscessus ATCC 19977
 
Mycobacterium sp. JLS

Gene: Mjls_4748: Protein of unknown function DUF867
 
Mycobacterium tuberculosis H37Rv

Gene: Rv0923c: Protein of unknown function DUF867
 
Mycobacterium vanbaalenii PYR-1
Protein of unknown function DUF867
 
CRON 3.
COG2119
*
Mycobacterium smegmatis str. MC2 155

Site:
position = -311
score = 4.89847
sequence = AGTATCGGTTACCCGAACAT

Gene: MSMEG_5329: Predicted manganese transporter, COG2119 family
*
Mycobacterium marinum M

Site:
position = -216
score = 4.5647
sequence = GGATACGGCCGCCCGAACTT

Gene: MMAR_5398: Predicted manganese transporter, COG2119 family
 
Mycobacterium leprae TN
 
Mycobacterium flavescens PYR-GCK

Gene: Mflv_2016: Predicted manganese transporter, COG2119 family
 
Mycobacterium avium 104
 
Mycobacterium abscessus ATCC 19977
*
Mycobacterium sp. JLS

Site:
position = -218
score = 4.3256
sequence = GAATACGGCTGTCCGAAAAC

Gene: Mjls_5425: Predicted manganese transporter, COG2119 family
*
Mycobacterium tuberculosis H37Rv

Site:
position = -217
score = 4.62495
sequence = AAATACGGGTGGCCGAACTT

Gene: Rv3848: Predicted manganese transporter, COG2119 family
*
Mycobacterium vanbaalenii PYR-1

Site:
position = -293
score = 5.19781
sequence = GTTTTGGGGTAGCCGAACTC

Gene: Mvan_4708: Predicted manganese transporter, COG2119 family
Predicted manganese transporter, COG2119 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD