Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 40 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 7 4
Arthrobacter chlorophenolicus A6 8 3
Arthrobacter sp. FB24 6 3
Beutenbergia cavernae DSM 12333 5 2
Brachybacterium faecium DSM 4810 5 2
Brevibacterium linens BL2 7 5
Clavibacter michiganensis subsp. michiganensis NCPPB 382 11 5
Janibacter sp. HTCC2649 4 1
Jonesia denitrificans DSM 20603 5 2
Kocuria rhizophila DC2201 3 1
Kytococcus sedentarius DSM 20547 4 1
Leifsonia xyli subsp. xyli str. CTCB07 5 2
Renibacterium salmoninarum ATCC 33209 7 4
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuA
*
Arthrobacter aurescens TC1

Site:
position = -2
score = 4.2062
sequence = AATTGTGTTTGATTCTCATTT

Gene: AAur_2632: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Arthrobacter chlorophenolicus A6

Site:
position = -73
score = 4.73673
sequence = AAATAGGAATGATTCCCATTT

Gene: Achl_2376: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Arthrobacter sp. FB24

Site:
position = -98
score = 4.38296
sequence = AAATAGGAATGATTCCTATTT

Site:
position = -55
score = 4.45671
sequence = TAATGCTCCTGATTCTCATGT

Gene: Arth_2641: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Beutenbergia cavernae DSM 12333

Site:
position = -39
score = 4.63486
sequence = TTTTGACATCGGTTCTCATCT

Gene: Bcav_1775: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Brachybacterium faecium DSM 4810

Site:
position = -8
score = 4.83483
sequence = TGGTGAGAATGATTGTCATGT

Gene: Bfae_17080: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Brevibacterium linens BL2

Gene: BlinB01001749: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -37
score = 5.49082
sequence = TAGTGAGACTGGTTATCAATA

Gene: CMM_2941: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Janibacter sp. HTCC2649

Site:
position = -39
score = 5.04525
sequence = AGTTGACAATCATTCTCAACT

Site:
position = -17
score = 5.20393
sequence = AGTTGAGAATGATTGTCATGA

Gene: JNB_04825: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Jonesia denitrificans DSM 20603

Site:
position = -8
score = 5.49958
sequence = TATTGATAATGGATCTCATGA

Gene: Jden_1533: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Kocuria rhizophila DC2201

Site:
position = -100
score = 4.56222
sequence = AGATGAGAATGGTTAGTGATA

Site:
position = -63
score = 4.7101
sequence = TGATGACACTGATTCTCATCG

Gene: KRH_09480: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Kytococcus sedentarius DSM 20547

Site:
position = -17
score = 4.1794
sequence = ACCTGAGAATCATTGTCATGC

Gene: Ksed_11830: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -86
score = 5.41821
sequence = TTTTGACAATCATTATCAACA

Gene: Lxx25040: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -62
score = 4.41685
sequence = TGTTGCACATCATTCTCGATA

Site:
position = -103
score = 4.48063
sequence = TTATGCGAATGATTCCGATTA

Gene: RSal33209_1398: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Arthrobacter aurescens TC1

Gene: AAur_2631: Zinc ABC transporter, ATP-binding protein ZnuC
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2375: Zinc ABC transporter, ATP-binding protein ZnuC
 
Arthrobacter sp. FB24

Gene: Arth_2640: Zinc ABC transporter, ATP-binding protein ZnuC
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_1774: Zinc ABC transporter, ATP-binding protein ZnuC
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17090: Zinc ABC transporter, ATP-binding protein ZnuC
 
Brevibacterium linens BL2

Gene: BlinB01001750: Zinc ABC transporter, ATP-binding protein ZnuC
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2940: Zinc ABC transporter, ATP-binding protein ZnuC
 
Janibacter sp. HTCC2649

Gene: JNB_04830: Zinc ABC transporter, ATP-binding protein ZnuC
 
Jonesia denitrificans DSM 20603

Gene: Jden_1534: Zinc ABC transporter, ATP-binding protein ZnuC
 
Kocuria rhizophila DC2201

Gene: KRH_09490: Zinc ABC transporter, ATP-binding protein ZnuC
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11820: Zinc ABC transporter, ATP-binding protein ZnuC
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx25025: Zinc ABC transporter, ATP-binding protein ZnuC
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1399: Zinc ABC transporter, ATP-binding protein ZnuC
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Arthrobacter aurescens TC1

Gene: AAur_2629: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2374: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Arthrobacter sp. FB24

Gene: Arth_2639: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_1773: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17100: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Brevibacterium linens BL2

Gene: BlinB01001751: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2939: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Janibacter sp. HTCC2649

Gene: JNB_04835: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Jonesia denitrificans DSM 20603

Gene: Jden_1535: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Kocuria rhizophila DC2201

Gene: KRH_09500: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11810: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx25020: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1400: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Arthrobacter aurescens TC1

Gene: AAur_2630: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2373: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Arthrobacter sp. FB24

Gene: Arth_2638: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_1772: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Brachybacterium faecium DSM 4810

Gene: Bfae_17110: Zinc homeostasis transcriptional regulator Zur, Fur family
*
Brevibacterium linens BL2

Site:
position = -94
score = 5.00875
sequence = TAATGGTAACGTTTTTCATTA

Gene: BlinB01002696: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_2938: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Janibacter sp. HTCC2649

Gene: JNB_04840: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Jonesia denitrificans DSM 20603

Gene: Jden_1536: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Kocuria rhizophila DC2201

Gene: KRH_09520: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_11800: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx25010: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1401: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Tropheryma whipplei str. Twist
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 2.
RSal33209_0614
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -39
score = 5.72178
sequence = TAATGATCATGATGATCATTA

Gene: RSal33209_0614: NADH-FMN oxidoreductase
 
Tropheryma whipplei str. Twist
NADH-FMN oxidoreductase
 
CRON 3.
RSal33209_0615
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -109
score = 5.72178
sequence = TAATGATCATCATGATCATTA

Gene: RSal33209_0615: transcriptional regulator, GntR family
 
Tropheryma whipplei str. Twist
transcriptional regulator, GntR family
 
CRON 4.
znuB2
*
Arthrobacter aurescens TC1

Site:
position = -2
score = 5.54117
sequence = TTTTGATAATGAATCTCAATA

Gene: AAur_1962: Zinc ABC transporter, inner membrane permease protein ZnuB
*
Arthrobacter chlorophenolicus A6

Site:
position = -37
score = 5.82644
sequence = TGTTGATAATGATTCTTATTA

Gene: Achl_2858: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -25
score = 5.45335
sequence = TAACAATAATGGTTATCATCA

Gene: BlinB01002692: Zinc ABC transporter, inner membrane permease protein ZnuB
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -40
score = 4.99115
sequence = AGTTGATAAGCATTCTCATTC

Gene: CMM_0175: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, inner membrane permease protein ZnuB
COG1520
 
Arthrobacter aurescens TC1

Gene: AAur_1963: WD40/YVTN repeat-like-containing domain
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2857: WD40/YVTN repeat-like-containing domain
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -31
score = 5.85923
sequence = CAATGAGAACCATTATCAATA

Gene: BlinB01002691: WD40/YVTN repeat-like-containing domain
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0176: WD40/YVTN repeat-like-containing domain
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
WD40/YVTN repeat-like-containing domain
znuA2
 
Arthrobacter aurescens TC1

Gene: AAur_1964: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2856: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2

Gene: BlinB01002690: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0177: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_3501: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, periplasmic-binding protein ZnuA
AAur_1965
 
Arthrobacter aurescens TC1

Gene: AAur_1965: WD40/YVTN repeat-like-containing domain
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2855: WD40/YVTN repeat-like-containing domain
*
Arthrobacter sp. FB24

Site:
position = -26
score = 5.77057
sequence = TAATGAGAATGACTATCATTT

Gene: Arth_4108: WD40/YVTN repeat-like-containing domain
*
Beutenbergia cavernae DSM 12333

Site:
position = -68
score = 5.08085
sequence = GAATGAGAATGACTCTCGTTA

Gene: Bcav_0090: WD40/YVTN repeat-like-containing domain
*
Brachybacterium faecium DSM 4810

Site:
position = -62
score = 4.96513
sequence = AGATGCGAACGATTATCAGTA

Site:
position = -17
score = 5.38419
sequence = TGATGAGAACGGTTTTCATGA

Gene: Bfae_30770: WD40/YVTN repeat-like-containing domain
 
Brevibacterium linens BL2

Gene: BlinB01002689: WD40/YVTN repeat-like-containing domain
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Gene: CMM_0178: WD40/YVTN repeat-like-containing domain
 
Janibacter sp. HTCC2649
*
Jonesia denitrificans DSM 20603

Site:
position = -30
score = 5.54463
sequence = TATTGATAATCGTTCCCAGTA

Gene: Jden_1380: WD40/YVTN repeat-like-containing domain
 2
Kocuria rhizophila DC2201

Gene: KRH_00830: WD40/YVTN repeat-like-containing domain

Gene: KRH_00820: WD40/YVTN repeat-like-containing domain
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_3218: WD40/YVTN repeat-like-containing domain
 
Tropheryma whipplei str. Twist
WD40/YVTN repeat-like-containing domain
 
CRON 5.
znuC2
*
Arthrobacter aurescens TC1

Site:
position = 23
score = 5.54117
sequence = TATTGAGATTCATTATCAAAA

Gene: AAur_1961: Zinc ABC transporter, ATP-binding protein ZnuC
*
Arthrobacter chlorophenolicus A6

Site:
position = -31
score = 5.82644
sequence = TAATAAGAATCATTATCAACA

Gene: Achl_2859: Zinc ABC transporter, ATP-binding protein ZnuC
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -25
score = 5.45335
sequence = TGATGATAACCATTATTGTTA

Gene: BlinB01002693: Zinc ABC transporter, ATP-binding protein ZnuC
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Zinc ABC transporter, ATP-binding protein ZnuC
 
CRON 6.
yciC
*
Arthrobacter aurescens TC1

Site:
position = -118
score = 6.00054
sequence = TATTGAGAATGCTTCTCAATA

Gene: AAur_2880: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Arthrobacter chlorophenolicus A6
*
Arthrobacter sp. FB24

Site:
position = -2
score = 5.6669
sequence = AAATGAGAATGATTCTCATAT

Gene: Arth_3252: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -33
score = 5.01537
sequence = AAATGAGAATCATTCGCATGT

Gene: RSal33209_1680: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Tropheryma whipplei str. Twist
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpmJ2
 
Arthrobacter aurescens TC1

Gene: AAur_2879: LSU ribosomal protein L36p
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24

Gene: Arth_3254: LSU ribosomal protein L36p
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
*
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -34
score = 5.60127
sequence = TATTGAGAACCGTTCTCGTGA

Gene: CMM_0025: LSU ribosomal protein L36p
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603

Gene: Jden_0071: LSU ribosomal protein L36p
 
Kocuria rhizophila DC2201

Gene: KRH_23160: LSU ribosomal protein L36p
 
Kytococcus sedentarius DSM 20547
*
Leifsonia xyli subsp. xyli str. CTCB07

Site:
position = -34
score = 5.56
sequence = TAATGATAATCTTTCTCAGTA

Gene: Lxx20595: LSU ribosomal protein L36p
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1679: LSU ribosomal protein L36p
 
Tropheryma whipplei str. Twist
LSU ribosomal protein L36p
 
CRON 7.
yciC2
 
Arthrobacter aurescens TC1
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
*
Brevibacterium linens BL2

Site:
position = -56
score = 5.55453
sequence = TATTGAGAACGAGTATTATTA

Gene: BlinB01002697: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*2
Clavibacter michiganensis subsp. michiganensis NCPPB 382

Site:
position = -32
score = 4.82981
sequence = AGATGAGAACGGTTCTCTTCT

Gene: CMM_0314: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Site:
position = -31
score = 5.60127
sequence = TCACGAGAACGGTTCTCAATA

Gene: CMM_0026: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_17280: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD