Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator
Biological process: Amino acid utilization
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 312 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 36 17
Shewanella putrefaciens CN-32 38 19
Shewanella sp W3-18-1 38 19
Shewanella sp ANA-3 37 18
Shewanella sp MR-4 37 18
Shewanella sp MR-7 37 18
Shewanella baltica OS155 38 19
Shewanella denitrificans OS217 38 18
Shewanella frigidimarina NCIMB 400 34 15
Shewanella amazonensis SB2B 37 18
Shewanella loihica PV-4 27 15
Shewanella pealeana ATCC 700345 34 16
Shewanella halifaxensis HAW-EB4 33 14
Shewanella piezotolerans WP3 33 16
Shewanella sediminis HAW-EB3 27 15
Shewanella woodyi ATCC 51908 34 17
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ldh
*
Shewanella oneidensis MR-1

Site:
position = -154
score = 5.15681
sequence = GTGGAAAGCTAGATTGCCAC

Gene: SO_2638: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella putrefaciens CN-32

Site:
position = -155
score = 5.15189
sequence = GTGGAAAGCTAAATTGCCAC

Gene: Sputcn32_2238: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella sp W3-18-1

Site:
position = -155
score = 5.15189
sequence = GTGGAAAGCTAAATTGCCAC

Gene: Sputw3181_1771: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella sp ANA-3

Site:
position = -154
score = 5.15681
sequence = GTGGAAAGCTAGATTGCCAC

Gene: Shewana3_1742: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella sp MR-4

Site:
position = -154
score = 5.15681
sequence = GTGGAAAGCTAGATTGCCAC

Gene: Shewmr4_1598: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella sp MR-7

Site:
position = -154
score = 5.15681
sequence = GTGGAAAGCTAGATTGCCAC

Gene: Shewmr7_1673: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella baltica OS155

Site:
position = -134
score = 5.15189
sequence = GTGGAAAGCTAAATTGCCAC

Gene: Sbal_2483: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella denitrificans OS217

Site:
position = -140
score = 4.94699
sequence = GTGGCAAGCAAAATTGCCAC

Gene: Sden_1823: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -178
score = 5.15189
sequence = GTGGCAAGCTAAATTTCCAC

Gene: Sfri_2265: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella amazonensis SB2B

Site:
position = -147
score = 5.08486
sequence = GTGGAAAGCAAAATTGCCAC

Gene: Sama_2067: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella loihica PV-4

Site:
position = -157
score = 5.08486
sequence = GTGGAAAGCAAAATTGCCAC

Gene: Shew_1555: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella pealeana ATCC 700345

Site:
position = -157
score = 4.86359
sequence = GTGGAAAGCAAAATTGCCAG

Gene: Spea_2543: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -157
score = 4.86359
sequence = GTGGAAAGCAAAATTGCCAG

Gene: Shal_1711: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella piezotolerans WP3

Site:
position = -158
score = 4.84402
sequence = GTGGAAAGCAGAATTGCCAC

Gene: swp_1857: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella sediminis HAW-EB3

Site:
position = -156
score = 5.15189
sequence = GTGGAAAGCTAAATTGCCAC

Gene: Ssed_1877: Leucine dehydrogenase (EC 1.4.1.9)
*
Shewanella woodyi ATCC 51908

Site:
position = -157
score = 5.08486
sequence = GTGGAAAGCAAAATTGCCAC

Gene: Swoo_2710: Leucine dehydrogenase (EC 1.4.1.9)
Leucine dehydrogenase (EC 1.4.1.9)
 
CRON 2.
mdeA
*
Shewanella oneidensis MR-1

Site:
position = -197
score = 3.94725
sequence = ATGTAACAACTTAGTTACAG

Gene: SO_1812: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella putrefaciens CN-32

Site:
position = -210
score = 4.10269
sequence = ATGTAACAAGTTAATTACAC

Gene: Sputcn32_1507: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella sp W3-18-1

Site:
position = -210
score = 4.10269
sequence = ATGTAACAAGTTAATTACAC

Gene: Sputw3181_2594: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella sp ANA-3

Site:
position = -208
score = 3.94725
sequence = ATGTAACAACTTAGTTACAG

Gene: Shewana3_2643: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella sp MR-4

Site:
position = -208
score = 3.94725
sequence = ATGTAACAACTTAGTTACAG

Gene: Shewmr4_2477: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella sp MR-7

Site:
position = -208
score = 3.94725
sequence = ATGTAACAACTTAGTTACAG

Gene: Shewmr7_2545: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella baltica OS155

Site:
position = -199
score = 4.10269
sequence = ATGTAACAAGTTAATTACAC

Gene: Sbal_1622: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella denitrificans OS217

Site:
position = -152
score = 4.25656
sequence = ATGTAACATAGTTTTTACAT

Gene: Sden_2521: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -148
score = 4.68512
sequence = TTGTAAAATTGTTTTTACAT

Gene: Sfri_1369: Methionine gamma-lyase (EC 4.4.1.11)
 
Shewanella amazonensis SB2B

Gene: Sama_1242: Methionine gamma-lyase (EC 4.4.1.11)
 
Shewanella loihica PV-4

Gene: Shew_2491: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella pealeana ATCC 700345

Site:
position = -215
score = 4.01807
sequence = ACGTAACAATCACTTTACAA

Gene: Spea_2664: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -214
score = 4.43128
sequence = TTGTAACATTCAGTTTACAA

Gene: Shal_2751: Methionine gamma-lyase (EC 4.4.1.11)
*
Shewanella piezotolerans WP3

Site:
position = -242
score = 4.08776
sequence = ACGTAACATATATTTTACAA

Gene: swp_3243: Methionine gamma-lyase (EC 4.4.1.11)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1559: Methionine gamma-lyase (EC 4.4.1.11)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3095: Methionine gamma-lyase (EC 4.4.1.11)
Methionine gamma-lyase (EC 4.4.1.11)
 
CRON 3.
omp2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155

Gene: Sbal_0959: putative TonB-dependent outer membrane receptor
*
Shewanella denitrificans OS217

Site:
position = -175
score = 4.32277
sequence = TCGTAAATAATTAGTTCCAC

Gene: Sden_2931: putative TonB-dependent outer membrane receptor
*
Shewanella frigidimarina NCIMB 400

Site:
position = -297
score = 5.05572
sequence = GTGTAAACCAATAGTTACAC

Gene: Sfri_3096: putative TonB-dependent outer membrane receptor
 
Shewanella amazonensis SB2B

Gene: Sama_2896: putative TonB-dependent outer membrane receptor
 
Shewanella loihica PV-4

Gene: Shew_3081: putative TonB-dependent outer membrane receptor
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -107
score = 4.06631
sequence = GTGTCAGGAATGTTTTACGT

Gene: Swoo_3992: putative TonB-dependent outer membrane receptor
putative TonB-dependent outer membrane receptor
 
CRON 4.
aroA
*
Shewanella oneidensis MR-1

Site:
position = -80
score = 3.63579
sequence = ATGTAGTGTGAAGTTGCCAT

Site:
position = -101
score = 3.79688
sequence = TAGTAACGTAAACTTGACGT

Gene: SO_2404: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella putrefaciens CN-32

Site:
position = -102
score = 4.54896
sequence = TTGTAATCTTAACTTGACGC

Site:
position = -299
score = 4.00688
sequence = TTGGCAAAAAAGCCTGCCAA

Gene: Sputcn32_2044: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella sp W3-18-1

Site:
position = -102
score = 4.54896
sequence = TTGTAATCTTAACTTGACGC

Site:
position = -298
score = 4.00688
sequence = TTGGCAAAAAAGCCTGCCAA

Gene: Sputw3181_1969: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella sp ANA-3

Site:
position = -102
score = 4.54896
sequence = TTGTAATCTTAACTTGACGC

Site:
position = -300
score = 3.89103
sequence = CTGGCAAAAAAGCCTGCCAA

Gene: Shewana3_1975: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella sp MR-4

Site:
position = -102
score = 4.54896
sequence = TTGTAATCTTAACTTGACGC

Site:
position = -300
score = 3.89103
sequence = CTGGCAAAAAAGCCTGCCAA

Gene: Shewmr4_1922: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella sp MR-7

Site:
position = -101
score = 4.54896
sequence = TTGTAATCTTAACTTGACGC

Site:
position = -298
score = 3.89103
sequence = CTGGCAAAAAAGCCTGCCAA

Gene: Shewmr7_2056: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella baltica OS155

Site:
position = -81
score = 3.72419
sequence = GTGTAGCGTGAAGTTGCCAT

Site:
position = -102
score = 4.54896
sequence = TTGTAATCTTAACTTGACGC

Site:
position = -299
score = 4.00688
sequence = TTGGCAAAAAAGCCTGCCAA

Gene: Sbal_2068: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella denitrificans OS217

Site:
position = -131
score = 4.48081
sequence = TTGGAAAGATAAGCTGACAA

Gene: Sden_1751: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -107
score = 4.11718
sequence = CTGTAATGAATTTGTTCCAC

Site:
position = -328
score = 4.32614
sequence = TTGGAAAGTTAACGTAACAA

Gene: Sfri_2125: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella amazonensis SB2B

Site:
position = -266
score = 3.78684
sequence = ATGGCAACAAATCTTGCAAT

Gene: Sama_1734: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella loihica PV-4

Site:
position = -268
score = 4.04909
sequence = TTGGCAAATTTTCATGCCAG

Gene: Shew_1952: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella pealeana ATCC 700345

Site:
position = -290
score = 4.1745
sequence = CCGGAAATTTTTAGTTCCAC

Gene: Spea_2071: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2043: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Shewanella piezotolerans WP3

Gene: swp_2488: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella sediminis HAW-EB3

Site:
position = -334
score = 3.76647
sequence = ATGGCATGAAATTGTTCCAG

Gene: Ssed_2300: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Shewanella woodyi ATCC 51908

Site:
position = -89
score = 3.93894
sequence = TTGTGTATCAATATTTGCAA

Site:
position = -323
score = 3.81698
sequence = CTGGCATGTTTTTCTTCCAC

Gene: Swoo_2309: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
CRON 5.
emrD
*
Shewanella oneidensis MR-1

Site:
position = -152
score = 4.50921
sequence = ATGTAAGCTTAATTTTACAG

Gene: SO_2389: multidrug resistance protein D
*
Shewanella putrefaciens CN-32

Site:
position = -114
score = 4.60324
sequence = GCGTAAGTTTAACTTTACAA

Site:
position = -257
score = 3.74361
sequence = ATATCAAGTATTTTATCCAC

Gene: Sputcn32_2030: multidrug resistance protein D
*
Shewanella sp W3-18-1

Site:
position = -114
score = 4.60324
sequence = GCGTAAGTTTAACTTTACAA

Site:
position = -257
score = 3.74361
sequence = ATATCAAGTATTTTATCCAC

Gene: Sputw3181_1983: multidrug resistance protein D
*
Shewanella sp ANA-3

Site:
position = -152
score = 4.61358
sequence = GTGTAAGCTTAGTTTGACAA

Gene: Shewana3_1989: multidrug resistance protein D
*
Shewanella sp MR-4

Site:
position = -152
score = 4.56364
sequence = GTGTAAGCTAAATTTTACAG

Site:
position = -218
score = 4.04401
sequence = GTGGCAATTAATTTTACCAG

Gene: Shewmr4_1936: multidrug resistance protein D
*
Shewanella sp MR-7

Site:
position = -152
score = 4.56364
sequence = GTGTAAGCTAAATTTTACAG

Site:
position = -218
score = 4.04401
sequence = GTGGCAATTAATTTTACCAG

Gene: Shewmr7_2040: multidrug resistance protein D
*
Shewanella baltica OS155

Site:
position = -154
score = 4.37084
sequence = ACGTAAGTTTAGCTTTACAG

Gene: Sbal_2085: multidrug resistance protein D
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -161
score = 3.95814
sequence = GTGTAAGCTTGCGTTTACAG

Site:
position = -182
score = 3.98484
sequence = CTGTAACGCCATCAATACAA

Gene: Ssed_2287: multidrug resistance protein D
*
Shewanella woodyi ATCC 51908

Site:
position = -160
score = 4.1316
sequence = TCGTAAGTATAGATTTACGC

Gene: Swoo_2329: multidrug resistance protein D
multidrug resistance protein D
 
CRON 6.
tdo
*
Shewanella oneidensis MR-1

Site:
position = -175
score = 4.5296
sequence = GTGTAAATAAAAAGTGGCAT

Gene: SO_4414: tryptophan 2,3-dioxygenase
*
Shewanella putrefaciens CN-32

Site:
position = -179
score = 4.5296
sequence = GTGTAAATAAAAAGTGGCAT

Gene: Sputcn32_0406: tryptophan 2,3-dioxygenase
*
Shewanella sp W3-18-1

Site:
position = -179
score = 4.5296
sequence = GTGTAAATAAAAAGTGGCAT

Gene: Sputw3181_0260: tryptophan 2,3-dioxygenase
*
Shewanella sp ANA-3

Site:
position = -179
score = 4.5296
sequence = GTGTAAATAAAAAGTGGCAT

Gene: Shewana3_0294: tryptophan 2,3-dioxygenase
*
Shewanella sp MR-4

Site:
position = -179
score = 4.5296
sequence = GTGTAAATAAAAAGTGGCAT

Gene: Shewmr4_0294: tryptophan 2,3-dioxygenase
*
Shewanella sp MR-7

Site:
position = -180
score = 4.5296
sequence = GTGTAAATAAAAAGTGGCAT

Gene: Shewmr7_3725: tryptophan 2,3-dioxygenase
*
Shewanella baltica OS155

Site:
position = -159
score = 4.56266
sequence = GTGTAAATAAAAAATGGCAT

Gene: Sbal_0303: tryptophan 2,3-dioxygenase
*
Shewanella denitrificans OS217

Site:
position = -122
score = 4.25633
sequence = TCGGAAGTTAAACTTTACAT

Gene: Sden_3451: tryptophan 2,3-dioxygenase
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3418: tryptophan 2,3-dioxygenase
 
Shewanella loihica PV-4

Gene: Shew_3557: tryptophan 2,3-dioxygenase
 
Shewanella pealeana ATCC 700345

Gene: Spea_3923: tryptophan 2,3-dioxygenase
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0260: tryptophan 2,3-dioxygenase
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
tryptophan 2,3-dioxygenase
kyn
 
Shewanella oneidensis MR-1

Gene: SO_4413: kynureninase (tryptophan degradation)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0407: kynureninase (tryptophan degradation)
 
Shewanella sp W3-18-1

Gene: Sputw3181_0261: kynureninase (tryptophan degradation)
 
Shewanella sp ANA-3

Gene: Shewana3_0295: kynureninase (tryptophan degradation)
 
Shewanella sp MR-4

Gene: Shewmr4_0295: kynureninase (tryptophan degradation)
 
Shewanella sp MR-7

Gene: Shewmr7_3724: kynureninase (tryptophan degradation)
 
Shewanella baltica OS155

Gene: Sbal_0304: kynureninase (tryptophan degradation)
 
Shewanella denitrificans OS217

Gene: Sden_3452: kynureninase (tryptophan degradation)
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_3417: kynureninase (tryptophan degradation)
 
Shewanella loihica PV-4

Gene: Shew_3556: kynureninase (tryptophan degradation)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3922: kynureninase (tryptophan degradation)
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3

Gene: swp_0261: kynureninase (tryptophan degradation)
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
kynureninase (tryptophan degradation)
 
CRON 7.
brnQ
*
Shewanella oneidensis MR-1

Site:
position = -121
score = 5.04758
sequence = GTGTAAACATAGGTTTGCAC

Gene: SO_0949: Branched-chain amino acid transport system carrier protein
*
Shewanella putrefaciens CN-32

Site:
position = -107
score = 5.12697
sequence = GTGTAAACATAGATTTGCAC

Gene: Sputcn32_0889: Branched-chain amino acid transport system carrier protein
*
Shewanella sp W3-18-1

Site:
position = -107
score = 5.12697
sequence = GTGTAAACATAGATTTGCAC

Gene: Sputw3181_3284: Branched-chain amino acid transport system carrier protein
*
Shewanella sp ANA-3

Site:
position = -106
score = 5.12697
sequence = GTGTAAACATAGATTTGCAC

Gene: Shewana3_3332: Branched-chain amino acid transport system carrier protein
*
Shewanella sp MR-4

Site:
position = -106
score = 5.12697
sequence = GTGTAAACATAGATTTGCAC

Gene: Shewmr4_0794: Branched-chain amino acid transport system carrier protein
*
Shewanella sp MR-7

Site:
position = -106
score = 5.12697
sequence = GTGTAAACATAGATTTGCAC

Gene: Shewmr7_3229: Branched-chain amino acid transport system carrier protein
*
Shewanella baltica OS155

Site:
position = -107
score = 5.05994
sequence = GTGTAAACAAAGATTTGCAC

Gene: Sbal_0842: Branched-chain amino acid transport system carrier protein
*
Shewanella denitrificans OS217

Site:
position = -229
score = 4.10354
sequence = GAGTATCGAAAAGTTTACAC

Gene: Sden_0746: Branched-chain amino acid transport system carrier protein
*
Shewanella frigidimarina NCIMB 400

Site:
position = -122
score = 4.84646
sequence = GTGTATTTTTAACTTTACAA

Gene: Sfri_0662: Branched-chain amino acid transport system carrier protein
*
Shewanella amazonensis SB2B

Site:
position = -109
score = 4.49148
sequence = CTGTAATTCTGGCGTTACAC

Gene: Sama_2740: Branched-chain amino acid transport system carrier protein
*
Shewanella loihica PV-4

Site:
position = -102
score = 4.61623
sequence = GTGTAATAAGAAGTTTACAC

Gene: Shew_0769: Branched-chain amino acid transport system carrier protein
*
Shewanella pealeana ATCC 700345

Site:
position = -90
score = 5.16326
sequence = GTGTAAAGTAATAATTACAC

Gene: Spea_0804: Branched-chain amino acid transport system carrier protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -94
score = 5.08386
sequence = GTGTAAACTAATCATTACAC

Gene: Shal_0859: Branched-chain amino acid transport system carrier protein
*
Shewanella piezotolerans WP3

Site:
position = -153
score = 4.9528
sequence = GTGTAAACCAAATATTACAC

Gene: swp_4229: Branched-chain amino acid transport system carrier protein
*
Shewanella sediminis HAW-EB3

Site:
position = -106
score = 4.59558
sequence = GTGTAATTGAAAGTTTACAC

Gene: Ssed_0892: Branched-chain amino acid transport system carrier protein
*
Shewanella woodyi ATCC 51908

Site:
position = -67
score = 5.06342
sequence = GTGTAATCTAAAGTTTACAC

Gene: Swoo_0894: Branched-chain amino acid transport system carrier protein
Branched-chain amino acid transport system carrier protein
 
CRON 8.
liuR
*
Shewanella oneidensis MR-1

Site:
position = -105
score = 4.61588
sequence = GTGGCAACAAGAATTGACAA

Gene: SO_1898: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella putrefaciens CN-32

Site:
position = -108
score = 4.47039
sequence = ATGGCAATTGGGATTGACAC

Gene: Sputcn32_1720: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella sp W3-18-1

Site:
position = -108
score = 4.47039
sequence = ATGGCAATTGGGATTGACAC

Gene: Sputw3181_2305: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella sp ANA-3

Site:
position = -105
score = 4.61588
sequence = GTGGCAACAAGAATTGACAA

Gene: Shewana3_1673: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella sp MR-4

Site:
position = -105
score = 4.61588
sequence = GTGGCAACAAGAATTGACAA

Gene: Shewmr4_2321: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella sp MR-7

Site:
position = -105
score = 4.61588
sequence = GTGGCAACAAGAATTGACAA

Gene: Shewmr7_2393: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella baltica OS155

Site:
position = -108
score = 4.47039
sequence = ATGGCAATTGGGATTGACAC

Gene: Sbal_2827: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella denitrificans OS217

Site:
position = -117
score = 4.20946
sequence = GTGGAAACAGAATTTAACAC

Gene: Sden_2244: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -117
score = 4.68249
sequence = GTGGCAAGCAAAATTAACAC

Gene: Sfri_2726: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella amazonensis SB2B

Site:
position = -123
score = 4.15023
sequence = CTGTAAGCTAAGCCTGACAC

Gene: Sama_1363: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
 
Shewanella loihica PV-4

Gene: Shew_2569: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella pealeana ATCC 700345

Site:
position = -111
score = 4.3715
sequence = GTGGCAAGCGCAATTGACAT

Gene: Spea_2796: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -110
score = 4.37642
sequence = GTGGCAAGCGCGATTGACAT

Gene: Shal_2901: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella piezotolerans WP3

Site:
position = -76
score = 4.1933
sequence = TTGGCACGCACAATTGACAT

Gene: swp_3441: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1459: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
*
Shewanella woodyi ATCC 51908

Site:
position = -129
score = 4.54719
sequence = CTGGAAAACTTACTTGCCAT

Gene: Swoo_3222: Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
Predicted transcriptional regulator LiuR of leucine degradation pathway, MerR family
liuA
 
Shewanella oneidensis MR-1

Gene: SO_1897: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1719: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2306: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella sp ANA-3

Gene: Shewana3_1672: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella sp MR-4

Gene: Shewmr4_2322: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella sp MR-7

Gene: Shewmr7_2394: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella baltica OS155

Gene: Sbal_2828: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella denitrificans OS217

Gene: Sden_2245: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2727: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella amazonensis SB2B

Gene: Sama_1362: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella loihica PV-4

Gene: Shew_2570: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2797: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2902: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella piezotolerans WP3

Gene: swp_3442: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1458: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3223: Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
Isovaleryl-CoA dehydrogenase (EC 1.3.99.10)
liuB
 
Shewanella oneidensis MR-1

Gene: SO_1896: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1718: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2307: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella sp ANA-3

Gene: Shewana3_1671: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella sp MR-4

Gene: Shewmr4_2323: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella sp MR-7

Gene: Shewmr7_2395: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella baltica OS155

Gene: Sbal_2829: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella denitrificans OS217

Gene: Sden_2246: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2728: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella amazonensis SB2B

Gene: Sama_1361: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella loihica PV-4

Gene: Shew_2571: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2798: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2903: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella piezotolerans WP3

Gene: swp_3443: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1457: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3224: Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
Methylcrotonyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.4)
liuC
 
Shewanella oneidensis MR-1

Gene: SO_1895: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1717: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2308: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella sp ANA-3

Gene: Shewana3_1670: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella sp MR-4

Gene: Shewmr4_2324: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella sp MR-7

Gene: Shewmr7_2396: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella baltica OS155

Gene: Sbal_2830: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella denitrificans OS217

Gene: Sden_2247: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2729: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella amazonensis SB2B

Gene: Sama_1360: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella loihica PV-4

Gene: Shew_2572: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2799: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2904: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella piezotolerans WP3

Gene: swp_3444: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1456: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3225: Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
Methylglutaconyl-CoA hydratase (EC 4.2.1.18)
liuD
 
Shewanella oneidensis MR-1

Gene: SO_1894: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1716: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2309: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella sp ANA-3

Gene: Shewana3_1669: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella sp MR-4

Gene: Shewmr4_2325: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella sp MR-7

Gene: Shewmr7_2397: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella baltica OS155

Gene: Sbal_2831: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella denitrificans OS217

Gene: Sden_2248: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2730: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella amazonensis SB2B

Gene: Sama_1359: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella loihica PV-4

Gene: Shew_2573: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2800: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 2
Shewanella halifaxensis HAW-EB4

Gene: Shal_2906: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)

Gene: Shal_2905: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 2
Shewanella piezotolerans WP3

Gene: swp_3445: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)

Gene: swp_3446: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1455: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3226: Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
Methylcrotonyl-CoA carboxylase biotin-containing subunit (EC 6.4.1.4)
Sden_2249
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217

Gene: Sden_2249: 3-methylcrotonyl-CoA carboxylase alpha subunit
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
3-methylcrotonyl-CoA carboxylase alpha subunit
liuE
 
Shewanella oneidensis MR-1

Gene: SO_1893: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1715: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2310: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella sp ANA-3

Gene: Shewana3_1668: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella sp MR-4

Gene: Shewmr4_2326: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella sp MR-7

Gene: Shewmr7_2398: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella baltica OS155

Gene: Sbal_2832: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella denitrificans OS217

Gene: Sden_2250: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2731: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella amazonensis SB2B

Gene: Sama_1358: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella loihica PV-4

Gene: Shew_2574: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2802: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2907: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella piezotolerans WP3

Gene: swp_3448: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1454: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3227: Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
Hydroxymethylglutaryl-CoA lyase (EC 4.1.3.4)
liuF
 
Shewanella oneidensis MR-1

Gene: SO_1892: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1714: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2311: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella sp ANA-3

Gene: Shewana3_1667: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella sp MR-4

Gene: Shewmr4_2327: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella sp MR-7

Gene: Shewmr7_2399: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella baltica OS155

Gene: Sbal_2833: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella denitrificans OS217

Gene: Sden_2251: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2732: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella amazonensis SB2B

Gene: Sama_1357: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella loihica PV-4

Gene: Shew_2575: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2803: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2908: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella piezotolerans WP3

Gene: swp_3449: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1453: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3228: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit A (EC 2.8.3.5)
liuG
 
Shewanella oneidensis MR-1

Gene: SO_1891: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1713: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2312: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella sp ANA-3

Gene: Shewana3_1666: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella sp MR-4

Gene: Shewmr4_2328: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella sp MR-7

Gene: Shewmr7_2400: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella baltica OS155

Gene: Sbal_2834: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella denitrificans OS217

Gene: Sden_2252: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2733: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella amazonensis SB2B

Gene: Sama_1356: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella loihica PV-4

Gene: Shew_2576: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2804: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2909: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella piezotolerans WP3

Gene: swp_3450: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1452: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3229: Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
Succinyl-CoA:3-ketoacid-coenzyme A transferase subunit B (EC 2.8.3.5)
 
CRON 9.
hmgC
*
Shewanella oneidensis MR-1

Site:
position = -239
score = 4.32352
sequence = ACGTAATGATTAGTTTACAG

Site:
position = -323
score = 3.8297
sequence = ATGTAACAGTATCGTTCCAC

Gene: SO_1670: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella putrefaciens CN-32

Site:
position = -268
score = 4.02177
sequence = ACGTAATGATTAGTTTACGA

Site:
position = -352
score = 3.94524
sequence = ATGTAACCGTATCGTTCCAC

Gene: Sputcn32_1389: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella sp W3-18-1

Site:
position = -268
score = 4.02177
sequence = ACGTAATGATTAGTTTACGA

Site:
position = -352
score = 3.94524
sequence = ATGTAACCGTATCGTTCCAC

Gene: Sputw3181_2712: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella sp ANA-3

Site:
position = -236
score = 4.43937
sequence = ACGTAATGATTAGTTTACAA

Site:
position = -320
score = 3.8297
sequence = ATGTAACAGTATCGTTCCAC

Gene: Shewana3_2778: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella sp MR-4

Site:
position = -235
score = 4.43937
sequence = ACGTAATGATTAGTTTACAA

Site:
position = -319
score = 3.8297
sequence = ATGTAACAGTATCGTTCCAC

Gene: Shewmr4_2604: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella sp MR-7

Site:
position = -235
score = 4.43937
sequence = ACGTAATGATTAGTTTACAA

Site:
position = -319
score = 3.8297
sequence = ATGTAACAGTATCGTTCCAC

Gene: Shewmr7_2671: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella baltica OS155

Site:
position = -274
score = 4.02177
sequence = ACGTAATGATTAGTTTACGA

Site:
position = -358
score = 3.8297
sequence = ATGTAACAGTATCGTTCCAC

Gene: Sbal_1487: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella denitrificans OS217

Site:
position = -146
score = 4.06206
sequence = TTGTACTGAAAAGTTTACAG

Site:
position = -228
score = 4.11952
sequence = ATGTAACGAATTAGTGCCAT

Gene: Sden_2592: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -155
score = 4.85232
sequence = TTGTAACGAATAATTTACAA

Gene: Sfri_1331: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella amazonensis SB2B

Site:
position = -150
score = 4.41982
sequence = CTGTATTTAAAAGTTTACAA

Site:
position = -234
score = 4.29557
sequence = GTGTAAAAAGAATTTGCCAG

Gene: Sama_2219: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella loihica PV-4

Site:
position = -169
score = 4.49333
sequence = CTGTCATGAATTGTTTACAA

Gene: Shew_1438: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella pealeana ATCC 700345

Site:
position = -197
score = 4.78048
sequence = GTGTATCTATAAGTTTACAC

Gene: Spea_1451: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -183
score = 4.66123
sequence = CTGTAAGTATAAGTTTACAA

Gene: Shal_1534: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella piezotolerans WP3

Site:
position = -179
score = 4.76526
sequence = CTGTAATTATATGTTTACAA

Gene: swp_1653: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella sediminis HAW-EB3

Site:
position = -155
score = 4.04389
sequence = GTGTAACTGTTTATTTACGT

Site:
position = -238
score = 3.99554
sequence = ATGTAAAAGCTTGTTGCCAC

Gene: Ssed_2927: Fumarylacetoacetase (EC 3.7.1.2)
*
Shewanella woodyi ATCC 51908

Site:
position = -172
score = 4.77762
sequence = CTGTAATTATTTATTTACAA

Site:
position = -256
score = 4.24974
sequence = ATGTAACAAGAGATTGCCAC

Gene: Swoo_1718: Fumarylacetoacetase (EC 3.7.1.2)
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
 
Shewanella oneidensis MR-1

Gene: SO_1671: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1390: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2711: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp ANA-3

Gene: Shewana3_2777: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp MR-4

Gene: Shewmr4_2603: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sp MR-7

Gene: Shewmr7_2670: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella baltica OS155

Gene: Sbal_1488: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella denitrificans OS217

Gene: Sden_2591: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1332: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella amazonensis SB2B

Gene: Sama_2218: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella loihica PV-4

Gene: Shew_1439: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1452: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1535: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella piezotolerans WP3

Gene: swp_1654: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2926: Maleylacetoacetate isomerase (EC 5.2.1.2)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1719: Maleylacetoacetate isomerase (EC 5.2.1.2)
Maleylacetoacetate isomerase (EC 5.2.1.2)
 
CRON 10.
putA
*
Shewanella oneidensis MR-1

Site:
position = -212
score = 4.83423
sequence = TTGTCAATCAAGCGTTACAT

Gene: SO_3774: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella putrefaciens CN-32

Site:
position = -194
score = 4.82931
sequence = TTGTCAATTAAGCGTTACAT

Gene: Sputcn32_3099: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella sp W3-18-1

Site:
position = -194
score = 4.82931
sequence = TTGTCAATTAAGCGTTACAT

Gene: Sputw3181_0845: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella sp ANA-3

Site:
position = -197
score = 4.55661
sequence = TTGTCAATTGAGCGTTACAT

Gene: Shewana3_0819: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella sp MR-4

Site:
position = -198
score = 4.55661
sequence = TTGTCAATTGAGCGTTACAT

Gene: Shewmr4_3122: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella sp MR-7

Site:
position = -197
score = 4.55661
sequence = TTGTCAATTGAGCGTTACAT

Gene: Shewmr7_0850: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella baltica OS155

Site:
position = -194
score = 4.83423
sequence = TTGTCAATCAAGCGTTACAT

Gene: Sbal_3458: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella denitrificans OS217

Gene: Sden_0689: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0568: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella amazonensis SB2B

Site:
position = -219
score = 4.01963
sequence = TTGTCAAGTGGGCGTTACGC

Gene: Sama_2676: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella loihica PV-4

Gene: Shew_0615: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella pealeana ATCC 700345

Gene: Spea_3490: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3585: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella piezotolerans WP3

Gene: swp_0809: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
*
Shewanella sediminis HAW-EB3

Site:
position = -109
score = 3.97489
sequence = TTGTATACAAAAAATAACAA

Gene: Ssed_3846: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0714: Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) / Delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12)
 
CRON 11.
tyrR
*
Shewanella oneidensis MR-1

Site:
position = -190
score = 4.70177
sequence = CTGTAAACTAGGCTTGCCAC

Gene: SO_1669: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella putrefaciens CN-32

Site:
position = -188
score = 4.76388
sequence = CTGTAAACTTGACTTGCCAC

Gene: Sputcn32_1388: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella sp W3-18-1

Site:
position = -188
score = 4.76388
sequence = CTGTAAACTTGACTTGCCAC

Gene: Sputw3181_2713: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella sp ANA-3

Site:
position = -205
score = 4.69685
sequence = CTGTAAACTAGACTTGCCAC

Gene: Shewana3_2779: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella sp MR-4

Site:
position = -205
score = 4.69685
sequence = CTGTAAACTAGACTTGCCAC

Gene: Shewmr4_2605: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella sp MR-7

Site:
position = -205
score = 4.69685
sequence = CTGTAAACTAGACTTGCCAC

Gene: Shewmr7_2672: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella baltica OS155

Site:
position = -196
score = 4.70177
sequence = CTGTAAACTAGGCTTGCCAC

Gene: Sbal_1486: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella denitrificans OS217

Site:
position = -155
score = 4.6379
sequence = CTGTAAACAAGACTTGCCAC

Gene: Sden_2593: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella frigidimarina NCIMB 400

Site:
position = -92
score = 4.66499
sequence = CTGTAAACTTCACTTGCCAC

Gene: Sfri_1330: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella amazonensis SB2B

Site:
position = -134
score = 4.6379
sequence = CTGTAAACAAGACTTGCCAC

Gene: Sama_2220: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella loihica PV-4

Site:
position = -162
score = 4.70133
sequence = GTGTAAACAACTCTTGCCAC

Gene: Shew_1437: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella pealeana ATCC 700345

Site:
position = -158
score = 4.57895
sequence = CTGTAAACAAGTCTTGCCAC

Gene: Spea_1450: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella halifaxensis HAW-EB4

Site:
position = -159
score = 4.09066
sequence = CTGTAAACAAGCCTTGCCAC

Gene: Shal_1533: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella piezotolerans WP3

Site:
position = -309
score = 4.57895
sequence = cTGTAAAcaagtCTTgcCAC

Gene: swp_1652: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella sediminis HAW-EB3

Site:
position = -151
score = 4.6379
sequence = CTGTAAACAAGACTTGCCAC

Gene: Ssed_2928: Transcriptional regulator of aromatic amino acid biosynthesis
*
Shewanella woodyi ATCC 51908

Site:
position = -161
score = 4.6379
sequence = CTGTAAACAAGACTTGCCAC

Gene: Swoo_1717: Transcriptional regulator of aromatic amino acid biosynthesis
Transcriptional regulator of aromatic amino acid biosynthesis
 
CRON 12.
pep1
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -136
score = 4.77717
sequence = TTGTAAATCAAGTGTTACAT

Gene: Sbal_3200: Alkaline serine exoprotease A precursor (EC 3.4.21.-)
*
Shewanella denitrificans OS217

Site:
position = -121
score = 4.89688
sequence = TTGTAAATTTATTGTTACAC

Gene: Sden_1016: Alkaline serine exoprotease A precursor (EC 3.4.21.-)
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
*
Shewanella woodyi ATCC 51908

Site:
position = -127
score = 5.00152
sequence = TTGTAAATATGATTTTACAC

Gene: Swoo_2373: Alkaline serine exoprotease A precursor (EC 3.4.21.-)
Alkaline serine exoprotease A precursor (EC 3.4.21.-)
 
CRON 13.
aprE2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
*
Shewanella sp ANA-3

Site:
position = -189
score = 4.70362
sequence = TTGTCATTCTTTATTTACAG

Gene: Shewana3_2745: Cold-active alkaline serine protease (EC 3.4.21.62)
*
Shewanella sp MR-4

Site:
position = -189
score = 4.62423
sequence = TTGTCATTCTTTGTTTACAG

Gene: Shewmr4_2570: Cold-active alkaline serine protease (EC 3.4.21.62)
*
Shewanella sp MR-7

Site:
position = -189
score = 4.62423
sequence = TTGTCATTCTTTGTTTACAG

Gene: Shewmr7_2637: Cold-active alkaline serine protease (EC 3.4.21.62)
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Cold-active alkaline serine protease (EC 3.4.21.62)
 
CRON 14.
pep2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3

Gene: Shewana3_2681: peptidase M4 thermolysin
 
Shewanella sp MR-4

Gene: Shewmr4_2515: peptidase M4 thermolysin
 
Shewanella sp MR-7

Gene: Shewmr7_2583: peptidase M4 thermolysin
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -140
score = 4.58662
sequence = GTGTAACTCATATGTTACAC

Gene: Sama_1201: peptidase M4 thermolysin
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3129: peptidase M4 thermolysin
peptidase M4 thermolysin
 
CRON 15.
pepD
 
Shewanella oneidensis MR-1

Gene: SO_1115: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella putrefaciens CN-32

Site:
position = -108
score = 3.87028
sequence = CTGGCAACTTTGGCTGCCAG

Gene: Sputcn32_0954: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella sp W3-18-1

Site:
position = -108
score = 3.87028
sequence = CTGGCAACTTTGGCTGCCAG

Gene: Sputw3181_3222: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
Shewanella sp ANA-3

Gene: Shewana3_0950: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
Shewanella sp MR-4

Gene: Shewmr4_0948: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
Shewanella sp MR-7

Gene: Shewmr7_0986: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella baltica OS155

Site:
position = -123
score = 4.00814
sequence = CTGGAAACTTTGGCTGCCAG

Gene: Sbal_0940: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
Shewanella denitrificans OS217

Gene: Sden_1011: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0962: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella amazonensis SB2B

Site:
position = -123
score = 4.36728
sequence = CTGGAAACTTTGGCTTCCAC

Gene: Sama_2519: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella loihica PV-4

Site:
position = -123
score = 4.5857
sequence = GTGGCAACTTAGTATGACAC

Gene: Shew_2852: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella pealeana ATCC 700345

Site:
position = -141
score = 4.50367
sequence = GTGGAAACTTTGGCTGACAA

Gene: Spea_3091: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -160
score = 4.58306
sequence = GTGGAAACTTTGCCTGACAA

Gene: Shal_3175: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella piezotolerans WP3

Site:
position = -140
score = 4.01319
sequence = ATGGCAACTTCTGCTGACAC

Gene: swp_1180: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3421: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
*
Shewanella woodyi ATCC 51908

Site:
position = -180
score = 3.83475
sequence = TTGGCAACTTTCAATGACAG

Gene: Swoo_3603: Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
Aminoacyl-histidine dipeptidase (Peptidase D) (EC 3.4.13.3)
 
CRON 16.
omp1
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -326
score = 4.79201
sequence = GTGTAACTACATATTTACAA

Gene: Sama_2026: TonB-dependent receptor
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
TonB-dependent receptor
pep4
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_2025: prolyl oligopeptidase family protein
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
prolyl oligopeptidase family protein
 
CRON 17.
Sfri_3409
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -55
score = 4.33158
sequence = AAGTCAAGCTTAGTTGACAT

Site:
position = -99
score = 4.67031
sequence = AAGTAAAGCTTACTTGACAC

Gene: Sfri_3409: hypothetical protein
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -45
score = 4.07685
sequence = ATGTAAAGGGTGTTTGACAT

Site:
position = -90
score = 4.39531
sequence = ATGTAAAGCATGCTTGACCT

Gene: Shew_3626: hypothetical protein
*
Shewanella pealeana ATCC 700345

Site:
position = -106
score = 3.94385
sequence = AAGTAAAGCAAGCTTGACTT

Site:
position = -62
score = 4.21402
sequence = AAGTCAAGCGTGCTTTACAT

Gene: Spea_0139: hypothetical protein
*
Shewanella halifaxensis HAW-EB4

Site:
position = -61
score = 4.54884
sequence = AAGTCAAGCTTACTTTACAT

Site:
position = -105
score = 3.87682
sequence = AAGTAAAGCATGCTTGACTT

Gene: Shal_4179: hypothetical protein
*
Shewanella piezotolerans WP3

Site:
position = -47
score = 4.43005
sequence = AAGTAAAGCTCACTTTACAA

Gene: swp_0181: hypothetical protein
*
Shewanella sediminis HAW-EB3

Site:
position = -111
score = 3.94385
sequence = AAGTAAAGCAAGCTTGACTT

Gene: Ssed_4363: hypothetical protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4744: hypothetical protein
hypothetical protein
Sfri_3410
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3410: transcriptional regulator, XRE family protein
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_3627: transcriptional regulator, XRE family protein
 
Shewanella pealeana ATCC 700345

Gene: Spea_0138: transcriptional regulator, XRE family protein
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_4180: transcriptional regulator, XRE family protein
 
Shewanella piezotolerans WP3

Gene: swp_0180: transcriptional regulator, XRE family protein
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4364: transcriptional regulator, XRE family protein
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4745: transcriptional regulator, XRE family protein
transcriptional regulator, XRE family protein
 
CRON 18.
prlC
*
Shewanella oneidensis MR-1

Site:
position = -147
score = 4.34041
sequence = GTGTAAATCCTAATTGAGAA

Gene: SO_4699: Oligopeptidase A (EC 3.4.24.70)
*
Shewanella putrefaciens CN-32

Site:
position = -189
score = 4.39592
sequence = ATGTAAATATTAATTGAGAA

Gene: Sputcn32_0087: Oligopeptidase A (EC 3.4.24.70)
*
Shewanella sp W3-18-1

Site:
position = -189
score = 4.39592
sequence = ATGTAAATATTAATTGAGAA

Gene: Sputw3181_3978: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella sp ANA-3

Gene: Shewana3_4051: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella sp MR-4

Gene: Shewmr4_3842: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella sp MR-7

Gene: Shewmr7_3935: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella baltica OS155

Gene: Sbal_0124: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella denitrificans OS217

Gene: Sden_3595: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3874: Oligopeptidase A (EC 3.4.24.70)
*
Shewanella amazonensis SB2B

Site:
position = -51
score = 4.32074
sequence = TTGCAAAACCTGCTTTGCAC

Gene: Sama_3546: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella loihica PV-4

Gene: Shew_3657: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4065: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0193: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella piezotolerans WP3

Gene: swp_4926: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_0145: Oligopeptidase A (EC 3.4.24.70)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0124: Oligopeptidase A (EC 3.4.24.70)
Oligopeptidase A (EC 3.4.24.70)
 
CRON 19.
SO1117
 
Shewanella oneidensis MR-1

Gene: SO_1117: peptidase M17, leucyl aminopeptidase
*
Shewanella putrefaciens CN-32

Site:
position = -116
score = 3.87028
sequence = CTGGCAGCCAAAGTTGCCAG

Gene: Sputcn32_0955: peptidase M17, leucyl aminopeptidase
*
Shewanella sp W3-18-1

Site:
position = -116
score = 3.87028
sequence = CTGGCAGCCAAAGTTGCCAG

Gene: Sputw3181_3221: peptidase M17, leucyl aminopeptidase
 
Shewanella sp ANA-3

Gene: Shewana3_0951: peptidase M17, leucyl aminopeptidase
 
Shewanella sp MR-4

Gene: Shewmr4_0949: peptidase M17, leucyl aminopeptidase
 
Shewanella sp MR-7

Gene: Shewmr7_0987: peptidase M17, leucyl aminopeptidase
*
Shewanella baltica OS155

Site:
position = -116
score = 4.00814
sequence = CTGGCAGCCAAAGTTTCCAG

Gene: Sbal_0941: peptidase M17, leucyl aminopeptidase
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0963: peptidase M17, leucyl aminopeptidase
*
Shewanella amazonensis SB2B

Site:
position = -45
score = 4.36728
sequence = GTGGAAGCCAAAGTTTCCAG

Gene: Sama_2518: peptidase M17, leucyl aminopeptidase
*
Shewanella loihica PV-4

Site:
position = -320
score = 4.5857
sequence = GTGTCATACTAAGTTGCCAC

Gene: Shew_2851: peptidase M17, leucyl aminopeptidase
*
Shewanella pealeana ATCC 700345

Site:
position = -111
score = 4.50367
sequence = TTGTCAGCCAAAGTTTCCAC

Gene: Spea_3090: peptidase M17, leucyl aminopeptidase
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -106
score = 4.01319
sequence = GTGTCAGCAGAAGTTGCCAT

Gene: swp_1181: peptidase M17, leucyl aminopeptidase
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3420: peptidase M17, leucyl aminopeptidase
*
Shewanella woodyi ATCC 51908

Site:
position = -151
score = 3.83475
sequence = CTGTCATTGAAAGTTGCCAA

Gene: Swoo_3602: peptidase M17, leucyl aminopeptidase
peptidase M17, leucyl aminopeptidase
 
CRON 20.
ipdC
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
*
Shewanella denitrificans OS217

Site:
position = -181
score = 4.20288
sequence = TTGTATACAAAATATGACAA

Gene: Sden_1376: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -138
score = 3.79663
sequence = GTGTCACGCCCGGATGACAG

Site:
position = -203
score = 3.94593
sequence = ACGTAAGCCAGGCTTTCCAA

Gene: Sama_1025: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
*
Shewanella loihica PV-4

Site:
position = -134
score = 4.13245
sequence = CTGTAACGATATCTTGTCAC

Gene: Shew_3635: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
*
Shewanella sediminis HAW-EB3

Site:
position = -211
score = 4.35531
sequence = GTGTAAAGCCGGGTCTACAC

Site:
position = -137
score = 4.24601
sequence = ATGTAAAGTTAACTGTACGT

Gene: Ssed_0171: Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
Shewanella woodyi ATCC 51908
Indole-3-pyruvate decarboxylase (EC 4.1.1.74)
 
CRON 21.
pep3
*
Shewanella oneidensis MR-1

Site:
position = -173
score = 4.18411
sequence = ATGGTAATTTTTAGTTACAA

Gene: SO_3844: peptidase, M13 family
*
Shewanella putrefaciens CN-32

Site:
position = -276
score = 3.6298
sequence = ATGTTAAGTTTATTTGCCTT

Gene: Sputcn32_0791: peptidase, M13 family
*
Shewanella sp W3-18-1

Site:
position = -276
score = 3.6298
sequence = ATGTTAAGTTTATTTGCCTT

Gene: Sputw3181_3384: peptidase, M13 family
*
Shewanella sp ANA-3

Site:
position = -172
score = 4.18411
sequence = ATGGTAATTTTTAGTTACAA

Gene: Shewana3_0759: peptidase, M13 family
*
Shewanella sp MR-4

Site:
position = -173
score = 4.18411
sequence = ATGGTAATTTTTAGTTACAA

Gene: Shewmr4_3179: peptidase, M13 family
*
Shewanella sp MR-7

Site:
position = -172
score = 4.18411
sequence = ATGGTAATTTTTAGTTACAA

Gene: Shewmr7_0787: peptidase, M13 family
*
Shewanella baltica OS155

Site:
position = -173
score = 3.99379
sequence = CTGGTAACCTTTAGTTACAT

Gene: Sbal_0685: peptidase, M13 family
*
Shewanella denitrificans OS217

Site:
position = -224
score = 3.78381
sequence = TTGGTTACATAAATTGCCAG

Gene: Sden_1089: peptidase, M13 family
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0842: peptidase, M13 family
 
Shewanella amazonensis SB2B

Gene: Sama_2615: peptidase, M13 family
*
Shewanella loihica PV-4

Site:
position = -180
score = 4.11541
sequence = GAGGAAATCTTTACTTACAT

Gene: Shew_2973: peptidase, M13 family
*
Shewanella pealeana ATCC 700345

Site:
position = -237
score = 3.76572
sequence = TGGGAAACCTTTTCTTACAC

Gene: Spea_3177: peptidase, M13 family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -202
score = 3.85714
sequence = TAGGAAACCTTTTCTTACAC

Gene: Shal_3258: peptidase, M13 family
*
Shewanella piezotolerans WP3

Site:
position = -189
score = 3.85714
sequence = TAGGAAACCTTTTCTTACAC

Gene: swp_3866: peptidase, M13 family
*
Shewanella sediminis HAW-EB3

Site:
position = -218
score = 4.03602
sequence = AAGGAAACCTTTACTTACAC

Gene: Ssed_3509: peptidase, M13 family
*
Shewanella woodyi ATCC 51908

Site:
position = -178
score = 3.71963
sequence = AAGGAAACCTTTTCTTACAT

Gene: Swoo_0911: peptidase, M13 family
peptidase, M13 family
 
CRON 22.
aprE
 
Shewanella oneidensis MR-1

Gene: SO_3106: Alkaline serine protease
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2477: Alkaline serine protease
 
Shewanella sp W3-18-1

Gene: Sputw3181_1531: Alkaline serine protease
*
Shewanella sp ANA-3

Site:
position = -357
score = 3.85355
sequence = TTTGAAATTATTCATTCCAA

Gene: Shewana3_1443: Alkaline serine protease
*
Shewanella sp MR-4

Site:
position = -357
score = 3.92058
sequence = TTTGAAATTAATCATTCCAA

Gene: Shewmr4_1390: Alkaline serine protease
*
Shewanella sp MR-7

Site:
position = -357
score = 3.92058
sequence = TTTGAAATTAATCATTCCAA

Gene: Shewmr7_1455: Alkaline serine protease
 
Shewanella baltica OS155

Gene: Sbal_2779: Alkaline serine protease
*
Shewanella denitrificans OS217

Site:
position = -105
score = 4.11543
sequence = GCGTATATAAATGGTTACAT

Gene: Sden_1409: Alkaline serine protease
*
Shewanella frigidimarina NCIMB 400

Site:
position = -333
score = 4.7263
sequence = CTGCAAAAATATCTTTACAC

Gene: Sfri_2692: Alkaline serine protease
 
Shewanella amazonensis SB2B

Gene: Sama_2185: Alkaline serine protease
 
Shewanella loihica PV-4

Gene: Shew_2443: Alkaline serine protease
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
*
Shewanella piezotolerans WP3

Site:
position = -171
score = 4.02413
sequence = ACGTAAAGAAATCTGTCCAC

Gene: swp_3159: Alkaline serine protease
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1611: Alkaline serine protease
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3041: Alkaline serine protease
Alkaline serine protease
 
CRON 23.
phhA
*
Shewanella oneidensis MR-1

Site:
position = -122
score = 4.3877
sequence = TTGTAATATTTGCTTTACGT

Gene: SO_1666: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella putrefaciens CN-32

Site:
position = -122
score = 4.3877
sequence = TTGTAATATTTGCTTTACGT

Gene: Sputcn32_1386: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella sp W3-18-1

Site:
position = -122
score = 4.3877
sequence = TTGTAATATTTGCTTTACGT

Gene: Sputw3181_2715: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella sp ANA-3

Site:
position = -122
score = 4.3877
sequence = TTGTAATATTTGCTTTACGT

Gene: Shewana3_2781: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella sp MR-4

Site:
position = -122
score = 4.38278
sequence = TTGTAATATTTACTTTACGT

Gene: Shewmr4_2607: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella sp MR-7

Site:
position = -122
score = 4.3877
sequence = TTGTAATATTTGCTTTACGT

Gene: Shewmr7_2674: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella baltica OS155

Site:
position = -122
score = 4.3877
sequence = TTGTAATATTTGCTTTACGT

Gene: Sbal_1484: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella denitrificans OS217

Site:
position = -127
score = 4.41929
sequence = TTGTATGCTTAAGTTTACAA

Gene: Sden_2595: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -121
score = 4.05912
sequence = TTGTATTTATTTGTTTACGA

Gene: Sfri_1328: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella amazonensis SB2B

Site:
position = -123
score = 4.3448
sequence = TTGTAATAAAAGCTTTACGA

Gene: Sama_2222: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella loihica PV-4

Site:
position = -87
score = 4.69301
sequence = ATGTAAATTTGAGGTTACAT

Gene: Shew_1435: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella pealeana ATCC 700345

Site:
position = -239
score = 4.31015
sequence = GTGTCAATTTCTATATACGC

Site:
position = -173
score = 4.75375
sequence = GTGTAACATTAGCATTACAC

Gene: Spea_1448: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -133
score = 4.28999
sequence = GTGTAACAACTTCGTTACAC

Gene: Shal_1531: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella piezotolerans WP3

Site:
position = -188
score = 4.59104
sequence = CTGTAAATTATGGCTTACAA

Site:
position = -123
score = 4.49937
sequence = ATGTAAACTTATGGTTACGC

Gene: swp_1650: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella sediminis HAW-EB3

Site:
position = -188
score = 3.67008
sequence = TCGTCAATAAATGGTGACGA

Site:
position = -122
score = 4.21611
sequence = TTGTAAGCAAATTGTTACAC

Gene: Ssed_2930: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
*
Shewanella woodyi ATCC 51908

Site:
position = -121
score = 4.5999
sequence = GTGTAACTTTTTGGTTACAA

Site:
position = -186
score = 3.7752
sequence = TTGGCAATAATTCAATACGA

Gene: Swoo_1715: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
 
Shewanella oneidensis MR-1

Gene: SO_1667: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1387: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2714: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella sp ANA-3

Gene: Shewana3_2780: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella sp MR-4

Gene: Shewmr4_2606: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella sp MR-7

Gene: Shewmr7_2673: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella baltica OS155

Gene: Sbal_1485: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella denitrificans OS217

Gene: Sden_2594: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1329: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella amazonensis SB2B

Gene: Sama_2221: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella loihica PV-4

Gene: Shew_1436: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella pealeana ATCC 700345

Gene: Spea_1449: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1532: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella piezotolerans WP3

Gene: swp_1651: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2929: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1716: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
 
CRON 24.
aceB
*
Shewanella oneidensis MR-1

Site:
position = -372
score = 3.72413
sequence = GTGTAATCATTGTTTTTCGA

Gene: SO_1483: Malate synthase (EC 2.3.3.9)
*
Shewanella putrefaciens CN-32

Site:
position = -304
score = 4.69121
sequence = GTGTAATTATAAATTTACGT

Gene: Sputcn32_1238: Malate synthase (EC 2.3.3.9)
*
Shewanella sp W3-18-1

Site:
position = -303
score = 4.49891
sequence = GTGTAATTATAAATTTACTT

Gene: Sputw3181_2866: Malate synthase (EC 2.3.3.9)
*
Shewanella sp ANA-3

Site:
position = -372
score = 4.29092
sequence = CTGTATATTTAAATTTTCAA

Gene: Shewana3_2943: Malate synthase (EC 2.3.3.9)
*
Shewanella sp MR-4

Site:
position = -372
score = 4.29092
sequence = CTGTATAGTTAAATTTTCAA

Gene: Shewmr4_2767: Malate synthase (EC 2.3.3.9)
*
Shewanella sp MR-7

Site:
position = -372
score = 3.81731
sequence = CTGTACATTTAAATTTTCAG

Gene: Shewmr7_2845: Malate synthase (EC 2.3.3.9)
*
Shewanella baltica OS155

Site:
position = -380
score = 3.58661
sequence = CTGTATTAATATATTTACTG

Gene: Sbal_1316: Malate synthase (EC 2.3.3.9)
*
Shewanella denitrificans OS217

Site:
position = -324
score = 3.99665
sequence = TTGTAAGTTATTATTTACTG

Gene: Sden_1245: Malate synthase (EC 2.3.3.9)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -458
score = 4.38871
sequence = tgGTAAAGaaAtATTTACAg

Gene: Sfri_1101: Malate synthase (EC 2.3.3.9)
*
Shewanella amazonensis SB2B

Site:
position = -450
score = 4.08538
sequence = TTGTAAATTAAATATTAAAT

Site:
position = -364
score = 3.73938
sequence = GTGTATTAAAAATCTTACAG

Gene: Sama_2381: Malate synthase (EC 2.3.3.9)
*
Shewanella loihica PV-4

Site:
position = -393
score = 3.37001
sequence = CTGTATCGACAAAATTACTA

Gene: Shew_1275: Malate synthase (EC 2.3.3.9)
*
Shewanella pealeana ATCC 700345

Site:
position = -415
score = 3.89022
sequence = GTGGCAATAATTGTTAACGA

Gene: Spea_1290: Malate synthase (EC 2.3.3.9)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -458
score = 4.12361
sequence = aTGTAAAagTAtATTgACgC

Gene: Shal_1352: Malate synthase (EC 2.3.3.9)
*
Shewanella piezotolerans WP3

Site:
position = -412
score = 4.16432
sequence = CTGTATTTATAATATTACAC

Gene: swp_1433: Malate synthase (EC 2.3.3.9)
*
Shewanella sediminis HAW-EB3

Site:
position = -371
score = 4.23351
sequence = CTGTAAGTTTATTTTTACGC

Gene: Ssed_1414: Malate synthase (EC 2.3.3.9)
*
Shewanella woodyi ATCC 51908

Site:
position = -401
score = 3.91313
sequence = GTGTATCATTAAGTTTACTT

Site:
position = -341
score = 3.6064
sequence = TTGGTAAATTTGTCTGACAA

Gene: Swoo_1528: Malate synthase (EC 2.3.3.9)
Malate synthase (EC 2.3.3.9)
aceA
 
Shewanella oneidensis MR-1

Gene: SO_1484: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1239: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2865: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella sp ANA-3

Gene: Shewana3_2942: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella sp MR-4

Gene: Shewmr4_2766: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella sp MR-7

Gene: Shewmr7_2844: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella baltica OS155

Gene: Sbal_1317: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella denitrificans OS217

Gene: Sden_1246: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1102: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella amazonensis SB2B

Gene: Sama_2380: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella loihica PV-4

Gene: Shew_1276: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1415: Isocitrate lyase (EC 4.1.3.1)
 
Shewanella woodyi ATCC 51908
Isocitrate lyase (EC 4.1.3.1)
 
CRON 25.
ivdA
*
Shewanella oneidensis MR-1

Site:
position = -159
score = 4.36367
sequence = CTGTAAATCCTGACTGACAA

Gene: SO_1677: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella putrefaciens CN-32

Site:
position = -167
score = 4.29981
sequence = CTGTAAATCCTTACTGACAA

Gene: Sputcn32_1397: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella sp W3-18-1

Site:
position = -167
score = 4.29981
sequence = CTGTAAATCCTTACTGACAA

Gene: Sputw3181_2704: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella sp ANA-3

Site:
position = -159
score = 4.36367
sequence = CTGTAAATCCTGACTGACAA

Gene: Shewana3_2771: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella sp MR-4

Site:
position = -159
score = 4.36367
sequence = CTGTAAATCCTGACTGACAA

Gene: Shewmr4_2597: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella sp MR-7

Site:
position = -159
score = 4.36367
sequence = CTGTAAATCCTGACTGACAA

Gene: Shewmr7_2664: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella baltica OS155

Site:
position = -162
score = 4.28376
sequence = CTGTAAATCCTTACTGACAT

Gene: Sbal_1495: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella denitrificans OS217

Site:
position = -159
score = 4.40354
sequence = GTGTAAATCTTCAGTGACAA

Gene: Sden_1943: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -140
score = 4.05236
sequence = CTGTAAATCTTCACTGACAA

Gene: Sfri_1338: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella amazonensis SB2B

Site:
position = -195
score = 3.82137
sequence = GTGTCAATCTCAGTTCCCGC

Site:
position = -173
score = 4.56062
sequence = CTGTAAATCCAGAGTGACAA

Gene: Sama_1375: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella loihica PV-4

Site:
position = -168
score = 4.42579
sequence = CTGTAAATTCAGCCTGACAA

Gene: Shew_1667: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella pealeana ATCC 700345

Site:
position = -231
score = 4.51009
sequence = GTGTAAATTCTATGTGACAA

Gene: Spea_2783: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -231
score = 4.44001
sequence = GTGTAAATCCTTTGTGACAT

Gene: Shal_2878: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella piezotolerans WP3

Site:
position = -75
score = 3.82776
sequence = TTTTAAGTTGATGTTTACAC

Gene: swp_3387: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella sediminis HAW-EB3

Site:
position = -185
score = 4.47754
sequence = CTGTAAATCCTGAGTGACAT

Gene: Ssed_1473: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
*
Shewanella woodyi ATCC 51908

Site:
position = -173
score = 4.71838
sequence = CTGTAAATCTTGAGTGACAT

Gene: Swoo_3202: 3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
3-ketoacyl-CoA thiolase [isoleucine degradation] (EC 2.3.1.16)
ivdB
 
Shewanella oneidensis MR-1

Gene: SO_1678: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1398: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2703: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella sp ANA-3

Gene: Shewana3_2770: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella sp MR-4

Gene: Shewmr4_2596: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella sp MR-7

Gene: Shewmr7_2663: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella baltica OS155

Gene: Sbal_1496: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella denitrificans OS217

Gene: Sden_1942: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1339: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella amazonensis SB2B

Gene: Sama_1376: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella loihica PV-4

Gene: Shew_1668: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2782: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2877: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella piezotolerans WP3

Gene: swp_3386: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1474: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3201: Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
Methylmalonate-semialdehyde dehydrogenase (EC 1.2.1.27)
ivdC
 
Shewanella oneidensis MR-1

Gene: SO_1679: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1399: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2702: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella sp ANA-3

Gene: Shewana3_2769: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella sp MR-4

Gene: Shewmr4_2595: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella sp MR-7

Gene: Shewmr7_2662: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella baltica OS155

Gene: Sbal_1497: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella denitrificans OS217

Gene: Sden_1941: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1340: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella amazonensis SB2B

Gene: Sama_1377: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella loihica PV-4

Gene: Shew_1669: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2781: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2876: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella piezotolerans WP3

Gene: swp_3385: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1475: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3200: Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
Branched-chain acyl-CoA dehydrogenase (EC 1.3.99.12)
ivdD
 
Shewanella oneidensis MR-1

Gene: SO_1680: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1400: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2701: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella sp ANA-3

Gene: Shewana3_2768: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella sp MR-4

Gene: Shewmr4_2594: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella sp MR-7

Gene: Shewmr7_2661: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella baltica OS155

Gene: Sbal_1498: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella denitrificans OS217

Gene: Sden_1940: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1341: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella amazonensis SB2B

Gene: Sama_1378: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella loihica PV-4

Gene: Shew_1670: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2780: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2875: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella piezotolerans WP3

Gene: swp_3384: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1476: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3199: Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
Enoyl-CoA hydratase [valine degradation] (EC 4.2.1.17) / Enoyl-CoA hydratase [isoleucine degradation] (EC 4.2.1.17)
ivdE
 
Shewanella oneidensis MR-1

Gene: SO_1681: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1401: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2700: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella sp ANA-3

Gene: Shewana3_2767: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella sp MR-4

Gene: Shewmr4_2593: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella sp MR-7

Gene: Shewmr7_2660: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella baltica OS155

Gene: Sbal_1499: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella denitrificans OS217

Gene: Sden_1939: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1342: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella amazonensis SB2B

Gene: Sama_1379: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella loihica PV-4

Gene: Shew_1671: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2779: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2874: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella piezotolerans WP3

Gene: swp_3383: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1477: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3198: 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4)
ivdF
 
Shewanella oneidensis MR-1

Gene: SO_1682: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1402: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2699: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella sp ANA-3

Gene: Shewana3_2766: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella sp MR-4

Gene: Shewmr4_2592: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella sp MR-7

Gene: Shewmr7_2659: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella baltica OS155

Gene: Sbal_1500: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella denitrificans OS217

Gene: Sden_1938: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1343: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella amazonensis SB2B

Gene: Sama_1380: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella loihica PV-4

Gene: Shew_1672: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2778: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2873: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella piezotolerans WP3

Gene: swp_3382: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1478: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3197: 3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
3-hydroxyisobutyrate dehydrogenase (EC 1.1.1.31)
ivdG
 
Shewanella oneidensis MR-1

Gene: SO_1683: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1403: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2698: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella sp ANA-3

Gene: Shewana3_2765: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella sp MR-4

Gene: Shewmr4_2591: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella sp MR-7

Gene: Shewmr7_2658: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella baltica OS155

Gene: Sbal_1501: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella denitrificans OS217

Gene: Sden_1937: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1344: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella amazonensis SB2B

Gene: Sama_1381: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella loihica PV-4

Gene: Shew_1673: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2777: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2872: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella piezotolerans WP3

Gene: swp_3381: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_1479: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_3196: 3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
3-hydroxyacyl-CoA dehydrogenase [isoleucine degradation] (EC 1.1.1.35)
 
CRON 26.
bkdA1
*
Shewanella oneidensis MR-1

Site:
position = -160
score = 4.91636
sequence = TTGTAAAGCAATATATACAT

Gene: SO_2339: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella putrefaciens CN-32

Site:
position = -160
score = 4.91636
sequence = TTGTAAAGCAATATATACAT

Gene: Sputcn32_1885: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella sp W3-18-1

Site:
position = -160
score = 4.91636
sequence = TTGTAAAGCAATATATACAT

Gene: Sputw3181_2123: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella sp ANA-3

Site:
position = -160
score = 4.84932
sequence = TTGTAAAGCATTATATACAT

Gene: Shewana3_2131: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella sp MR-4

Site:
position = -160
score = 4.84932
sequence = TTGTAAAGCATTATATACAT

Gene: Shewmr4_2028: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella sp MR-7

Site:
position = -160
score = 4.84932
sequence = TTGTAAAGCATTATATACAT

Gene: Shewmr7_1947: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella baltica OS155

Site:
position = -160
score = 4.91636
sequence = TTGTAAAGCAATATATACAT

Gene: Sbal_4508: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella denitrificans OS217

Site:
position = -153
score = 4.48424
sequence = GCGTAAAGCAAATTATACAA

Gene: Sden_1786: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -156
score = 4.49875
sequence = TCGTAAAGCAATATATACAT

Gene: Sfri_1935: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella amazonensis SB2B

Site:
position = -150
score = 4.29316
sequence = CTGTAAAGCAATTAATACAT

Gene: Sama_1709: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella loihica PV-4

Site:
position = -175
score = 4.70177
sequence = TTGTAAAGCTAGCGATACAT

Gene: Shew_1925: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella pealeana ATCC 700345

Site:
position = -161
score = 4.82092
sequence = ATGTAAACCAATATATACAT

Gene: Spea_2246: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -161
score = 4.82092
sequence = ATGTAAACCAATATATACAT

Gene: Shal_2234: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella piezotolerans WP3

Site:
position = -162
score = 4.82092
sequence = ATGTAAACCAATATATACAT

Gene: swp_2606: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella sediminis HAW-EB3

Site:
position = -172
score = 4.40072
sequence = TTGTAAAGCTAAAGATACGC

Gene: Ssed_2329: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
*
Shewanella woodyi ATCC 51908

Site:
position = -171
score = 4.03349
sequence = ATGTAAAGCTAAACATACGG

Gene: Swoo_2278: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
bkdA2
 
Shewanella oneidensis MR-1

Gene: SO_2340: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1886: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2122: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella sp ANA-3

Gene: Shewana3_2130: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella sp MR-4

Gene: Shewmr4_2027: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella sp MR-7

Gene: Shewmr7_1948: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella baltica OS155

Gene: Sbal_4507: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella denitrificans OS217

Gene: Sden_1787: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1936: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella amazonensis SB2B

Gene: Sama_1710: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella loihica PV-4

Gene: Shew_1926: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2245: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2233: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella piezotolerans WP3

Gene: swp_2605: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2328: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2279: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
bkdB
 
Shewanella oneidensis MR-1

Gene: SO_2341: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1887: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella sp W3-18-1

Gene: Sputw3181_2121: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella sp ANA-3

Gene: Shewana3_2129: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella sp MR-4

Gene: Shewmr4_2026: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella sp MR-7

Gene: Shewmr7_1949: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella baltica OS155

Gene: Sbal_4506: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella denitrificans OS217

Gene: Sden_1788: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1937: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella amazonensis SB2B

Gene: Sama_1711: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella loihica PV-4

Gene: Shew_1927: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella pealeana ATCC 700345

Gene: Spea_2244: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_2232: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella piezotolerans WP3

Gene: swp_2604: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2327: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_2280: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
 
CRON 27.
tyrB
*
Shewanella oneidensis MR-1

Site:
position = -155
score = 3.47343
sequence = TCGGCAGGCTTTTTTGCCAG

Gene: SO2406: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella putrefaciens CN-32

Site:
position = -156
score = 4.00688
sequence = TTGGCAGGCTTTTTTGCCAA

Gene: Sputcn32_2045: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella sp W3-18-1

Site:
position = -156
score = 4.00688
sequence = TTGGCAGGCTTTTTTGCCAA

Gene: Sputw3181_1967: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella sp ANA-3

Site:
position = -155
score = 3.89103
sequence = TTGGCAGGCTTTTTTGCCAG

Gene: Shewana3_1974: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella sp MR-4

Site:
position = -155
score = 3.89103
sequence = TTGGCAGGCTTTTTTGCCAG

Gene: Shewmr4_1921: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella sp MR-7

Site:
position = -155
score = 3.89103
sequence = TTGGCAGGCTTTTTTGCCAG

Gene: Shewmr7_2057: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella baltica OS155

Site:
position = -156
score = 4.00688
sequence = TTGGCAGGCTTTTTTGCCAA

Gene: Sbal_2067: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella denitrificans OS217

Site:
position = -269
score = 4.48081
sequence = TTGTCAGCTTATCTTTCCAA

Gene: Sden_1750: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -130
score = 4.32614
sequence = TTGTTACGTTAACTTTCCAA

Gene: Sfri_2126: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella amazonensis SB2B

Site:
position = -224
score = 3.78684
sequence = ATTGCAAGATTTGTTGCCAT

Gene: Sama_1733: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella loihica PV-4

Site:
position = -141
score = 4.04909
sequence = CTGGCATGAAAATTTGCCAA

Gene: Shew_1951: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella pealeana ATCC 700345

Site:
position = -138
score = 4.1745
sequence = GTGGAACTAAAAATTTCCGG

Gene: Spea_2070: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -243
score = 3.36918
sequence = TCGTAGATATAAAGTTACTC

Gene: Shal_2042: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella piezotolerans WP3

Site:
position = -147
score = 4.23545
sequence = TTGGAATCAATAATTGCCAG

Gene: swp_2486: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella sediminis HAW-EB3

Site:
position = -135
score = 3.76647
sequence = CTGGAACAATTTCATGCCAT

Gene: Ssed_2301: Tyrosine aminotransferase (EC 2.6.1.42)
*
Shewanella woodyi ATCC 51908

Site:
position = -178
score = 3.67072
sequence = TTTAAAAGCAAACTTGCCAA

Site:
position = -153
score = 3.81698
sequence = GTGGAAGAAAAACATGCCAG

Gene: Swoo_2308: Tyrosine aminotransferase (EC 2.6.1.42)
Tyrosine aminotransferase (EC 2.6.1.42)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD