Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CzrA - Clostridia-3

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector: Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides pectinophilus ATCC 43243 3 1
Blautia hansenii DSM 20583
Bryantella formatexigens DSM 14469 3 1
Clostridiales bacterium 1_7_47_FAA 3 1
Clostridium bolteae ATCC BAA-613 3 1
Clostridium nexile DSM 1787 1 1
Clostridium scindens ATCC 35704 2 1
Dorea formicigenerans ATCC 27755
Dorea longicatena DSM 13814 3 1
Eubacterium eligens ATCC 27750 3 1
Eubacterium rectale ATCC 33656 2 1
Roseburia intestinalis L1-82 3 2
Ruminococcus gnavus ATCC 29149 2 1
Ruminococcus lactaris ATCC 29176
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
PF00403
*
Bacteroides pectinophilus ATCC 43243

Site:
position = -87
score = 6.94351
sequence = CATATGAATGATTGTTCATATG

Gene: BACPEC_01957: Heavy-metal-associated domain
 
Blautia hansenii DSM 20583
*
Bryantella formatexigens DSM 14469

Site:
position = -41
score = 7.59281
sequence = CATATGAATAAATGTTCATATG

Gene: BRYFOR_04019: Heavy-metal-associated domain
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100022157: Heavy-metal-associated domain
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_01423: Heavy-metal-associated domain
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
*
Dorea longicatena DSM 13814

Site:
position = -62
score = 7.34499
sequence = CATATGAATAACTGTTCATATA

Gene: DORLON_02327: Heavy-metal-associated domain
*
Eubacterium eligens ATCC 27750

Site:
position = -63
score = 7.34499
sequence = CATATGAATGAATGTTCATATG

Gene: EUBELI_01434: Heavy-metal-associated domain
*
Eubacterium rectale ATCC 33656

Site:
position = -78
score = 6.17876
sequence = CATATGAACAATCATTCATATG

Gene: EUBREC_2969: Heavy-metal-associated domain
 
Roseburia intestinalis L1-82

Gene: ROSINTL182_01064: Heavy-metal-associated domain
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
Heavy-metal-associated domain
cadA
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_01958: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_04020: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Clostridiales bacterium 1_7_47_FAA

Gene: Cbac1_010100022162: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Clostridium bolteae ATCC BAA-613

Gene: CLOBOL_01422: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Clostridium nexile DSM 1787

Site:
position = -51
score = 5.09777
sequence = AATATGGTTATATGAACATATG

Site:
position = -35
score = 5.69279
sequence = CATATGAACAATCACTCATATG

Gene: CLONEX_04065: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Clostridium scindens ATCC 35704

Site:
position = -63
score = 7.59281
sequence = CATATGAATAACTGTTCATATG

Gene: CLOSCI_04034: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 2
Dorea formicigenerans ATCC 27755

Gene: DORFOR_02523: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)

Gene: DORFOR_02521: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Dorea longicatena DSM 13814

Gene: DORLON_02326: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01433: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_2968: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Roseburia intestinalis L1-82

Site:
position = -28
score = 6.88673
sequence = CATATGAATACATGAACATATG

Gene: ROSINTL182_01062: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Ruminococcus gnavus ATCC 29149

Site:
position = -28
score = 6.63892
sequence = CATATGAACAGCTATTCATGTG

Gene: RUMGNA_00975: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Ruminococcus lactaris ATCC 29176
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
czrA
 
Bacteroides pectinophilus ATCC 43243

Gene: BACPEC_01959: Cadmium-dependent transcriptuin regulator, ArsR family
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_04021: Cadmium-dependent transcriptuin regulator, ArsR family
*
Clostridiales bacterium 1_7_47_FAA

Site:
position = -54
score = 6.17876
sequence = CATATGAACAATCATTCATATG

Gene: Cbac1_010100022152: Cadmium-dependent transcriptuin regulator, ArsR family
*
Clostridium bolteae ATCC BAA-613

Site:
position = -55
score = 6.17876
sequence = CATATGAACAATCATTCATATG

Gene: CLOBOL_01424: Cadmium-dependent transcriptuin regulator, ArsR family
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_04035: Cadmium-dependent transcriptuin regulator, ArsR family
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_02522: Cadmium-dependent transcriptuin regulator, ArsR family
 
Dorea longicatena DSM 13814

Gene: DORLON_02325: Cadmium-dependent transcriptuin regulator, ArsR family
 
Eubacterium eligens ATCC 27750

Gene: EUBELI_01432: Cadmium-dependent transcriptuin regulator, ArsR family
 
Eubacterium rectale ATCC 33656
*
Roseburia intestinalis L1-82

Site:
position = -58
score = 5.63602
sequence = CATATGAACAGATAAGAATATG

Gene: ROSINTL182_01065: Cadmium-dependent transcriptuin regulator, ArsR family
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_00977: Cadmium-dependent transcriptuin regulator, ArsR family
 
Ruminococcus lactaris ATCC 29176
Cadmium-dependent transcriptuin regulator, ArsR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD